Pyrosequencing was carried out using the PSQ96MA system (Biotage, Uppsala, Sweden), Pyro Q-CpG software (Biotage, Uppsala, Sweden), and a PyroMark kit (Qiagen, Hilden, Germany). PCR product was bound to Streptavidin-Sepharose HP (GE Healthcare, Uppsala, Sweden), purified, washed, denatured using a 0.2 M NaOH solution, and washed again. Strand separation and purification of the single-stranded template were facilitated using the Vacuum Prep Tool (Biotage, Uppsala, Sweden). The purified single-stranded template was then added to the sequencing mixture containing annealing buffer and the following sequencing primers: BRAF: 5’-GATTTTGGTCTAGCTACA-3’, LINE-1: 5’-AGTTAGGTGTGGGATATAGT-3’, IGFBP7: YGGGTGTTYGTTTATTTT-3’, hMLH1: 5’- AGTTATAGTTGAAGGAAGAA -3’, and CD133: 5’- GGGATATGGGGGTATAAAG -3’, as per published reports (Table 1 ),[19 (link)–21 (link)] then incubated at 85°C for 2 minutes, and allowed to cool to room temperature. Pyrosequencing was carried out in a PyroMark ID instrument (Biotage, Uppsala, Sweden), and the data were analyzed using sequence analysis software from the manufacturer. The amount of C relative to the sum of the amounts of C and T at each CpG site was calculated as a percentage. The average of the relative amounts of C in the CpG sites was defined as the overall methylation level of each gene in the colon polyps.
Psq96ma system
Manufactured by Biotage
Sourced in Sweden
The PSQ96MA system is a pyrosequencing platform designed for DNA analysis. It provides automated sample preparation and sequencing capabilities. The system is capable of generating DNA sequence data through a pyrosequencing process, which is a real-time DNA sequencing method.
Automatically generated - may contain errors
Lab products found in correlation
Pyro q cpg software, by Biotage (2 mentions)
Pyromark kit, by Qiagen (1 mentions)
Streptavidin sepharose hp, by GE Healthcare (1 mentions)
Vacuum prep tool, by Biotage (1 mentions)
Pyromark q96 id software, by Qiagen (1 mentions)
Dneasy blood tissue kit, by Qiagen (1 mentions)
Pyro q cpg 1, by Biotage (1 mentions)
Psq assay design software, by Biotage (1 mentions)
Streptavidin sepharose hp beads, by Cytiva (1 mentions)
Epitect bisulfite kit, by Qiagen (1 mentions)
Faststart taq polymerase, by Roche (1 mentions)
5 protocols using psq96ma system
1
Pyrosequencing Analysis of Methylation Levels
2
Genetic Profiling of Nicotinic Receptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from peripheral blood using the DNeasy Blood & Tissue Kit (Qiagen) and was quantified by spectrophotometry (ND-2000c, NanoDrop Products, Wilmington, DE, USA). SNP-containing fragments were PCR-amplified using SNP-specific primers (Supplementary Table S1 ). Then, six SNPs were genotyped by pyrosequencing: rs2072661 in CHRNB2 (chr. 1), four SNPs mapping to CHRNA5 (rs503464, rs55853698, rs55781567 and rs16969968 on chr. 15q25), and rs2236196 mapping in CHRNA4 (chr. 20q13). Pyrosequencing was performed on a PSQ96MA system (Biotage, Uppsala, Sweden) running PyroMark Q96 ID Software (Qiagen). Additionally, a 22-bp insertion/deletion (ins/del, rs3841324), 71 bp upstream of the CHRNA5 transcription start site, was genotyped by 3% agarose gel electrophoresis.
3
Quantitative Pyrosequencing of miR-3151 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers for pyrosequencing were used for the amplification of miR-3151 promoter region, which was overlapped with the amplicon of MSP. Primers were designed by PSQ Assay Design software (Biotage). Bisulfite-treated DNA was amplified by PCR with a forward primer (5′-ATGGATAGATGGGTTAGAGATTG-3′) and a biotinylated reverse primer (5′-AATAAACCAAATAAATTCTATCTCC-3′) in the following condition: 2 mM/59°C/50X. A stretch of DNA with 6 adjacent CpG dinucleotides was pyrosequenced using sequencing primer: 5′- GAGAGTTTAGGGAGTTTTAGTTTT-3′. Bisulfite-treated DNA (2μl) was used as template in a PCR reaction with final volume of 50μl. The PCR products were purified and loaded onto 6% non-denaturing polyacrylamide gels with a mass ladder (Fermentas) and stained with ethidium bromide staining for sizing and quantification. Biotin-labeled PCR fragments (5 pmoles) of each sample were subjected to pyrosequencing using the PSQ96MA System (Biotage) and analyzed using PyroQ-CpG 1.0.9, according to manufacturer's instructions.
4
Bisulfite Pyrosequencing for DNA Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used bisulfite pyrosequencing to examine the methylation status of 19 selected genes in the 74 tumor samples and four samples of normal liver tissue. The primer sequences and locations used for the methylation analysis are shown in Table S2 and Figure S1. This enabled us to determine the level of methylation at each CpG site in a sample after bisulfite treatment. Genomic DNA (500 ng) was modified with sodium bisulfite using an EpiTect bisulfite kit (Qiagen), after which bisulfite pyrosequencing was carried out as described previously.16 Following PCR, the biotinylated product was purified, made single‐stranded, and used as a template in the pyrosequencing reaction. Briefly, the PCR product was bound to streptavidin Sepharose beads HP (Amersham Biosciences, Amersham, UK), after which beads containing the immobilized product were purified, washed, and denatured using a 0.2 mol/L NaOH solution. After addition of 0.3 μmol/L sequencing primer to the purified PCR product, pyrosequencing was carried out using a PSQ96MA system (Biotage, Uppsala, Sweden) and Pyro Q‐CpG software (Biotage). The methylation levels at different CpG sites, as measured by pyrosequencing, were averaged to represent the degree of methylation in each sample for each gene.
5
Methylation Analysis of AHRR and F2RL3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We investigated the methylation status of the AHRR (cg5575921) and F2LR3 (cg03636183) promoters. PCR was performed with FastStart Taq polymerase (Roche Applied Science, IN, USA) using 2 ml of bisulfite modified DNA and 3 mM MgCl2, 50 mM dNTPs, and 0.2 mM primer mixture. Pyrosequencing was performed using a PSQ96MA system (Biotage, Uppsala, Sweden) according to the manufacturer’s protocol. PCR primer sequences and pyrosequencing primers are shown in (Table 1 ). For sequencing, the assay was validated using an internal control (non-CpG cytosine in targeted methylation sequence region). AHRR and F2RL3 methylation for each sample was calculated as the average value of eight CpGs (mC/total C x 100 (%)) of the promoter CpG islands examined.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!