Pcr 8 gw topo ta

Predicted transcript from Ae. aegypti TRPA locus (AAEL001268) were assembled from VectorBase (https://vectorbase.org/vectorbase/app/). Ae. aegypti TRPA1 cDNAs for each isoform were isolated from total RNA from newly hatched Ae. aegypti (black eye Liverpool, purchased from the BEI Resources repository) by retrotranscription using Superscript III reverse transcription (Life Technologies) using gene-specific primers (see Key resources table) followed by PCR. The gene specific primers for the 5′ end included the Kozak sequence CAAAAC just upstream of the ATG. All cDNAs were cloned into pCR8/GW/TOPO® TA (Invitrogen) and sequenced before being transferred into pAC-GW expression vector for in vitro expression. Note that our nomenclature follows vectorbase, and that our AaegTRPA1-C/K/I and AaegTRPA1-G correspond to variants A and C of reference,^{35 (link)} respectively.

The 5.5 Kb region upstream of the ctgfa coding sequence was amplified with the following primers: ctgfa Fw: 5′-ATCGATTTTGGCTACTTTCAGCTAAGACTGG-3′ and ctgfa Rev: 5′- ATCGATTCTTTAAAGTTTGTAGCAAAAAGAAA-3′. The amplified sequence was inserted into pCR8-GW-topoTA (Invitrogen K2500-20) to generate a pEntry vector that was subsequently recombined with a Gateway vector containing LR recombination sites upstream of a mCherry-P2A-NTR2.0 cassette. The final construct was injected into fertilized zebrafish embryos along with I-SceI, using standard transgenesis techniques. The allele designation for this line is pd372.

BAM1 and bam1-2D coding sequences including start and stop codons were generated from Col-0 or bam1-2D cDNA by PCR using Platinum high-fidelity DNA polymerase (Invitrogen: thermofisher.com). Site-directed mutagenesis (Q5 Mutagenesis, New England BioLabs: neb.com) of BAM1 cDNA was used to convert Ser132 into Ala or Asp. Primers used are given in Supplemental Table S4.
Fragments were cloned using the cloning kit pCR8/GW/TOPO/TA (Invitrogen). Plasmids were sequenced using primers listed in Supplemental Table S4. Using Clonase II in the LR reaction, inserts were transferred into the Destination vector pGWB2, a Gateway Binary vector for the expression of proteins in plants driven by a 35S promoter (Nakagawa et al., 2007 (link)).
pGWB2 constructs were transformed into electrocompetent Agrobacterium tumefaciens strain Agl1. Arabidopsis plants were transformed using the floral dip method (Zhang et al., 2006 (link)). Seeds were sterilized with chlorine gas then screened on 0.8% (w/v) agar plates containing MS + 1% (w/v) sucrose, 20-μg mL⁻¹ nystatin, 50-μg mL⁻¹ kanamycin and 50-μg mL⁻¹ hygromycin. After 48 h in the dark at 4°C, plates were incubated with 16-h light (150 μmol quanta m⁻² s⁻¹) 8-h dark at 20°C. Transformed seedlings were selected at 10–14 d and transferred to soil. PCR was used to check for correct insertions in T1 and T2 plants.

The entire coding sequences (CDSs) of OeBAS, OeMAS, CYP716A48, and CYP716C67 were amplified from cDNA of olive leaves of cv Leccino, using iProof High‐Fidelity DNA Polymerase (Bio‐Rad) and gene‐specific primers (Table S2). CYP72A67 was amplified from Medicago truncatula Gaertn. root cDNA using Phusion polymerase (NEB, Ipswich, MA, USA; Table S2). The Centella asiatica L. CYP716C11 gene was synthesized with flanking Gateway® attB1 sites (IDT). OeBAS, OeMAS, and CYP716A48 amplification products were cloned into the Gateway vector pCR8‐GWTOPO‐T/A (Thermo Fisher). CYP716C67, CYP72A67, and CYP716C611 were cloned into pDONR207 using BP Clonase II Enzyme Mix (Thermo Fisher). All entry clones were sequenced to verify their integrity before LR reaction.
To generate constructs for yeast expression, OeBAS and OeMAS were subcloned into the vector pYES2‐DEST52, under the control of a galactose‐inducible promoter, using Gateway LR Clonase (Thermo Fisher), yielded the Saccharomyces cerevisiae expression constructs.
For the generation of constructs for Nicotiana benthamiana Domin. expression, OeBAS, OeMAS, CYP716A48, CYP72A67, and CYP716C611 were subcloned from the relevant entry vectors (pCR8 or pDONR 207) into pEAQ‐HT‐DEST1 (Sainsbury et al., 2009 (link)) vector using LR Clonase Mix (Thermo Fisher).

Gr28B mutants were obtained by imprecise excision of a Minos insertion in the last exon of the Gr28B locus (Mi{ET1}Gr28b^MB03888; BDSC#24190). Excision 8 caused a 207 bp deletion and the insertion of a 7-bp Minos footprint, producing a frame shift and premature stop in the coding sequence. As a control, we also generated a precise excision from the same insertion (Gr28B Exc66). In both cases, the full genomic Gr28B locus was sequenced to confirm the effect of excision. For rescue, we expressed a Gr28B.d cDNA in the Gr28b Exc8 mutant background using HC-LexA. To create 13LexAop-Gr28b.d transgene, we prepared a cDNA library from total mRNA extracted from D. melanogaster whole bodies using Superscript III reverse transcription (Life Technologies). We then amplified the full-length Gr28B.d cDNA with primers Dmel Gr28B.d FWD 5′- CAaaacATGTCATTTTACTTTTGCG-3′ and Dmel Gr28B.d REV 5′- AAACGATTAAAAATTTATTTCCAATC -3′ (Kozak sequence for Drosophila in lower case letters) also included in Supplementary table 1. Next, we cloned the PCR product into pCR™8/GW/TOPO® TA (ThermoFisher), confirmed its identity by sequencing, and then transferred it into a p13LexAop destination vector, created by ligating the Gateway® cassette from pMartini Gate C R2-R1 (Addgene plasmid #36436) cut with XhoI and XbaI into pJFRC19-13XLexAop2-IVS-myr::GFP (Addgene plasmid #2622).