HCT116 and HT29 cells were transfected with LRH-1 siRNA #1, #2 or with siLUC. Total RNA was prepared 24 h later using the RNeasy Mini Preparation Kit (QIAGEN). Following assessment of RNA integrity, four independent biological replicates for each siRNA treatment were used for microarray analysis. The analysis was performed using HumanHT-12 v4 Expression BeadChip (Illumina, UK). The BeadChip image data were pre-processed using GenomeStudio (Illumina). Raw data were filtered prior to normalization to remove non-expressed probes (if for a given probe the detection P-values for all samples were >0.05 it was considered not expressed). The expression data were log2 transformed and quantile-normalized using Partek Genomics Suite (Partek, USA). The microarray data have been deposited with the NCBI Gene Expression Omnibus (GEO) (http://ncbi.nlm.nih.gov/geo/ ) under accession number GSE65815. Pathway analyses were performed using the database for annotation, visualization and integrated discovery (DAVID; http://david.abcc.ncifcrf.gov ) (44 (link),45 (link)).
Rneasy mini preparation kit
Manufactured by Qiagen
Sourced in United Kingdom
The RNeasy Mini Preparation Kit is a laboratory equipment used for the purification and isolation of high-quality total RNA from a variety of sample types. The kit utilizes a silica-membrane technology to efficiently capture and purify RNA molecules, enabling researchers to obtain reliable and consistent results for their experiments.
Automatically generated - may contain errors
Lab products found in correlation
Nebnext ultra rna library prep kit, by Illumina (2 mentions)
Novaseq 6000, by Illumina (2 mentions)
Genomestudio, by Illumina (1 mentions)
Humanht 12 v4 expression beadchip, by Illumina (1 mentions)
Revertaid m mulv, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Revertra ace qpcr rt master mix kit, by Toyobo (1 mentions)
Abi prism 7500 detector, by Thermo Fisher Scientific (1 mentions)
5 protocols using rneasy mini preparation kit
1
Microarray Analysis of LRH-1 Knockdown in Colorectal Cancer Cells
2
RNA Extraction, cDNA Synthesis, and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was collected using RNeasy Mini Preparation Kit (QIAGEN, UK) according to the manufacturer's instructions. cDNA was synthesized from 2 μg RNA using RevertAidTM M-MuLV reverse transcriptase (Fermentas, UK). Obtained cDNA was diluted 1:10 and 2 μl was used in each PCR. Gene expression analyses were carried out using an Applied Biosystems 7900HT Fast Real-Time PCR System with TaqMan® gene expression assays (Applied Biosystems, UK) for LRH-1 (Hs00892377_m1), CDKN1A (Hs00355782_m1), TP53 (Hs01034249_m1) and GAPDH (Hs99999905_m1).
3
Quantification of Secreted Gaussia Luciferase
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Micelles containing GLuc mRNA were incubated with 50% fetal bovine serum (FBS; Thermo Scientific Fisher Inc., U.S.A) at 37°C for 15 min. The final mRNA concentration was 50 ng/μL. The mRNA was then extracted by the RNeasy Mini Preparation Kit (Qiagen, Hilden, Germany). The mRNA was then reverse-transcribed with the ReverTra Ace qPCR RT Master Mix kit (Toyobo Life Science, Osaka, Japan), followed by quantitative real-time PCR (qRT-PCR) using an ABI Prism 7500 Detector (Applied Biosystems, Foster City, CA, U.S.A) and a primer pair for GLuc (Forward: TGAGATTCCTGGGTTCAAGG, Reverse: GTCAGAACACTGCACGTTGG).
4
RNA-Seq Analysis of Mutant Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted for six biological replicates, using the QIAGEN RNeasy Mini Preparation Kit (QIAGEN Ltd, Crawley, UK). Library preparation using the NEBNext® Ultra™ RNA Library Prep Kit and 150bp paired-end sequencing was carried out on the Illumina Novaseq 6000 platform at the Beijing Genomics Institute. Using a Bcbio 1.1.1 RNA-seq pipeline, reads were aligned using Hisat2 2.1.0 [67 (link)], counted using DEXSeq [68 (link)] and Salmon 0.11.3 [69 (link)] and normalised using the R package DESeq2 [70 (link)]. DESeq2 was also used to determine differentially expressed genes between WT and mutant cell lines using shrunken log2 fold changes. Heatmaps were generated using the gplots R package. GSEA analysis was performed using the Molecular Signatures Database ‘Hallmarks’ gene set collection [71 (link)]. Venn diagrams were created using jvenn [72 (link)]. Grouping of knock-in clones was visualised using the t-Distributed Stochastic Neighbour Embedding (t-SNE) method for dimensionality reduction, using regularised log2-transformed (rlog) read counts as input. The t-SNE model was run using the ‘Rtsne’ R package, with a perplexity of 30, theta of 0.5, and other parameters kept at default settings. RNA-seq data have been deposited with the NCBI Gene Expression Omnibus (GEO) (http://ncbi.nlm.nih.gov/geo/ ) under accession number GSE147745.
5
RNA-Seq Analysis of Mutant Cell Lines
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!