Ni nitrilotriacetic acid resin

Expression and purification of XLF and Lig4/XRCC4 (LX4) were carried out according to (7 (link)). Briefly, a construct containing full-length 10xHis-tagged XLF and LX4 were expressed in insect cells. Following expression, cell pellets were resuspended in lysis buffer [20 mM tris (pH 8.0), 5% glycerol, 50 mM KCl, 50 mM NaCl, 5 mM β-mercaptoethanol, 25 mM imidazole, and 2 protein inhibitor cocktail tablets per liter], and cells were sonicated. The resulting lysate was then mixed with 2 μl of benzonase (25 kU of stock, activity per microliter, origin) and MgCl₂ to a final concentration of 5 mM and left on ice for 20 min. The lysate was then centrifuged (30,000g for 20 min at 4°C). The supernatant was purified using Ni–nitrilotriacetic acid resin (QIAGEN) previously equilibrated with lysis buffer and eluted using the lysis buffer containing 300 mM imidazole. Eluted XLF was bound to a Resource Q sepharose anion exchange column in buffer A [20 mM tris (pH 8.0), 50 mM KCl, 50 mM NaCl, 5 mM β-mercaptoethanol, and 1 mM EDTA] and eluted using a linear gradient of buffer A with 850 mM NaCl. Last, the protein was dialyzed into a final buffer of 10 mM tris (pH 8.0), 150 mM NaCl, and 5 mM β-mercaptoethanol before being stored at −80°C for further use (7 (link)).

Recombinant GRA2, amino acids 21 to 185, was produced using the gene sequence of RH strain[25 (link)]. Briefly, recombinant Escherichia coli bacteria were induced with 1 mM isopropyl-D-thiogalactopyranoside (IPTG), centrifuged and resuspended in buffer A (10 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl at pH 9.0, 0.1% Triton X-100, and proteases inhibitor cocktail without EDTA [Roche, Mannheim, Germany]). The mixture was sonicated at 4 °C and centrifuged at 12,000 ×g at 4 °C for 30 min. The supernatant was recovered, incubated with Ni-nitrilotriacetic acid resin (Qiagen, Courtaboeuf, France) and transferred to an empty column. Following sequential washes of the column with buffers B, C, and D (buffers having the same composition as buffer A but containing 20, 40, and 80 mM imidazole, respectively), the recombinant proteins were eluted with buffer E (buffer having the same composition as buffer A but containing 400 mM imidazole). Purified recombinant GRA2 protein was analyzed by SDS-PAGE, dialyzed against PBS, and stored in aliquots at -20 °C.

CaSWC4-6×His was expressed in E. coli strain BL21 and purified using Ni-nitrilotriacetic acid resin (Qiagen). The wild-type or mutated AT-rich fragment was synthesized by PCR using a single-stranded primer and another single-stranded primer labeled with Cy5.
EMSA was carried out as described previously [108 (link)]. The recombinant CaSWC4-6×His proteins were incubated with wild-type or mutated probe, which was labeled with the Cy5 fluorochrome, and 5× binding buffer (1 M Tris-HCl, pH 7.5, 5 M NaCl, 1 M KCl, 1 M MgCl₂, 0.5 M EDTA, pH 8.0, 10 mg/ml bovine serum albumin). The mixture was separated by PAGE and scanned on the Odyssey CLX imaging system (LI-COR).

Nicotiana benthamiana and Arabidopsis were grown in a growth chamber under a 16/8h light/dark cycle at 25 °C. The T-DNA insertion line for AtALY4 used in this study was AtALY4 (CS331800) supplied by the Arabidopsis Resource Center (http://www.arabidopsis.org). The PCR primers (P1, GGGCATCAGGAGTTGAAGTT; P2, GGATCCCATAGATCCCATGA; and LBa1, GCGTGGAC CGCTTGCTGCAACT) were used to check the T-DNA insertions. To prepare Nep1_Mo, overnight cultures of Escherichia coli BL21 cells carrying pET32b harbouring the Nep1_Mo gene (GenBank accession no. MGG_08454) were diluted (1:100) in Luria–Bertani medium containing ampicillin (50mg ml^–1) and incubated at 37 °C for ~3h. When the OD₆₀₀ of the culture reached 0.6, Nep1_Mo secretion into the culture medium was induced via the addition of 0.4mM isopropyl-β-d-thiogalactopyranoside for 6h. Nep1_Mo was expressed as a His-tag fusion protein. Protein purification was performed with Ni-nitrilotriacetic acid resin (QIAGEN, Valencia, CA, USA), and the purified proteins were dialysed against a phosphate-buffered saline (PBS) buffer (pH 7.4) and stored at 20 °C prior to use. Protein concentration was determined using the Bradford reagent (Qutob et al., 2006 (link)), and concentrated stock solution (500nM) was prepared.