Log In Sign up
The largest database of trusted experimental protocols

Amaxa human b cell nucleofection kit

Manufactured by Lonza
Visit Supplier
Sourced in Germany

The Amaxa Human B-cell Nucleofection Kit is a lab equipment product designed for the transfection of human B-cells. It provides a method for the efficient delivery of DNA, RNA, or other molecules into these cells.

Automatically generated - may contain errors

Lab products found in correlation

Sirna oligos, by Horizon Discovery (1 mentions)

Spelling variants of this product

Nucleofection (130 citations) Amaxa nucleofection (40 citations) Nucleofection Kit (19 citations) Amaxa nucleofection kit (14 citations) Human nucleofection kit (4 citations) Amaxa kits (2 citations)

3 protocols using amaxa human b cell nucleofection kit

1

Electroporation of siRNA into CLL Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Electroporation of siRNA into CLL cells was performed using Amaxa Human B-cell Nucleofection Kit (Amaxa, Cologne, Germany). 1x107 PBMCs were mixed with 100 μL of Amaxa B-cell nucleofector solution, and 2 μg of siRNA was nucleofected using program X-005 [29 (link)]. Transfection efficiency, assessed by transfection with 2 μg pMaxGFP plasmid, was 30–60% with cell viability of 50–80% at 24 hours. siRNA oligos were synthesized by Dharmacon (Lafayette, CO). Sense strand against human ASK1: GCUCGUAAUUUAUACACUGUU.
Paiva C., Godbersen J.C., Soderquist R.S., Rowland T., Kilmarx S., Spurgeon S.E., Brown J.R., Srinivasa S.P, & Danilov A.V. (2015). Cyclin-Dependent Kinase Inhibitor P1446A Induces Apoptosis in a JNK/p38 MAPK-Dependent Manner in Chronic Lymphocytic Leukemia B-Cells. PLoS ONE, 10(11), e0143685.
+ Open protocol
+ Expand
2

Efficient siRNA Delivery into CLL Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Electroporation of siRNA into CLL cells was performed using Amaxa Human B-cell Nucleofection Kit (Amaxa, Cologne, Germany) as previously described.45 (link) Briefly, 1 × 107 PBMCs were mixed with 100 μl of Amaxa B-cell nucleofector solution, and 2 μg of siRNA was nucleofected using program X-05. This resulted in transfection efficiency of 30–60% (as determined with 2 μg pMaxGFP plasmid) and viability of 50–80% cells at 24 h. The following siRNA sequences were used (sense strand): Cdt1, 5′-GCAAUGUUGGCCAGAUCAA-3′ p27, 5′-GCAACCGACGAUUCUUCUACUCA-3′ p21, 5′-CUGUACUGUUCUGUGUCUU-3' (all from Dharmacon, Lafayette, CO, USA).
Paiva C., Godbersen J.C., Berger A., Brown J.R, & Danilov A.V. (2015). Targeting neddylation induces DNA damage and checkpoint activation and sensitizes chronic lymphocytic leukemia B cells to alkylating agents. Cell Death & Disease, 6(7), e1807-.
+ Open protocol
+ Expand
3

Electroporation of siRNA into CLL Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Electroporation of siRNA into CLL cells was performed using Amaxa Human B-cell Nucleofection Kit (Amaxa, Cologne, Germany). 1×107 PBMCs were mixed with 100 μL of Amaxa B-cell nucleofector solution, and 2 μg of siRNA was nucleofected using program X-05. Transfection efficiency, assessed by transfection with 2 μg pMaxGFP plasmid, was 30-60% with cell viability of 50-80% at 24 hours. siRNA oligos were synthesized by Dharmacon (Lafayette, CO). Sense strand against human Bim1: GACCGAGAAGGUAGACAAUUU, Bim2: CUACCUCCCUACAGACAGAUU, Noxa8: GUAAUUAUUGACACAUUUCUU, Noxa9: AGUCGAGUGUGCUACUCAATT, Puma1: GCCUGUAAGAUACUGUAUAUU.
Godbersen J.C., Humphries L.A., Danilova O.V., Kebbekus P.E., Brown J.R., Eastman A, & Danilov A.V. (2014). The Nedd8-activating enzyme inhibitor MLN4924 thwarts microenvironment-driven NFκB activation and induces apoptosis in chronic lymphocytic leukemia B-cells. Clinical cancer research : an official journal of the American Association for Cancer Research, 20(6), 1576-1589.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!