Log In Sign up
The largest database of trusted experimental protocols

Jsh 23

Manufactured by Santa Cruz Biotechnology
Visit Supplier
Sourced in United States

JSH-23 is a laboratory reagent used in research applications. It is a selective inhibitor of the transcription factor NF-κB. The core function of JSH-23 is to modulate NF-κB signaling pathways in cell-based studies.

Automatically generated - may contain errors

Lab products found in correlation

Diphenylene iodonium, by Bio-Techne (2 mentions) Superoxide dismutase, by Merck Group (2 mentions) Myriocin, by Merck Group (1 mentions) Quinidine, by Merck Group (1 mentions) Thalidomide, by Merck Group (1 mentions) Cimetidine, by Merck Group (1 mentions) Clotrimazole, by Merck Group (1 mentions) Het0016, by Cayman Chemical (1 mentions) Skf 525 a, by Merck Group (1 mentions) L cycloserine, by Merck Group (1 mentions) Nedd8, by Cell Signaling Technology (1 mentions) Moloney murine leukemia virus reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Oligo dt primer, by Thermo Fisher Scientific (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Fetal bovine serum (fbs), by Cytiva (1 mentions) Tnf α, by R&D Systems (1 mentions) Ifn γ, by R&D Systems (1 mentions) Trypsin inhibitor, by Merck Group (1 mentions) Tnf α, by Thermo Fisher Scientific (1 mentions) Noggin, by Thermo Fisher Scientific (1 mentions)

9 protocols using jsh 23

1

Conditional Immortalization of Mouse Neural Progenitor Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The CTX12 cell line is a conditionally immortalised mouse NPC line derived from E12-5 mouse cortex that has been generated in-house at King’s College London by Dr. Bithell and Dr. Williams. Cells were grown on poly-d-lysine (PDL)/laminin-coated plastic (Sigma) in modified Sato’s medium (modified Sato’s medium: Dulbecco’s modified Eagle’s medium (DMEM)/F12 supplemented with 5.6 mg/ml glucose, 100 μg/ml bovine serum albumin (BSA), 16 μg/ml putrescine, 60 ng/ml progesterone, 400 ng/ml l-thyroxine, 300 ng/ml 3,3′,5-triiodothyronine, 5 μg/ml insulin, 5 μg/ml apo-transferrin, 5 ng/ml sodium selenite, 1× glutamine, 1× pen/strep) containing 10 ng/ml fibroblast growth factor 2 (FGF2), 20 ng/ml epidermal growth factor (EGF) and 100 nM 4-hydroxytamoxifen (4-OHT). Medium was changed every 2–3 days and cells passaged using trypsin-EDTA and trypsin inhibitor (Sigma). For astrocyte differentiation, CTX12 cells were plated at 0.5 × 105 cells/cm2 and cultured in modified Sato’s medium with 10 % foetal bovine serum (FBS) or 20 ng/ml bone morphogenetic protein 4 (BMP4) (Peprotech and R&D Systems). Where indicated, cells were treated with additional factors: noggin (500 ng/ml), TNF-α (50 ng/ml) (Peprotech) and JSH-23 nuclear factor-κB (NFκB) Activation Inhibitor II (JSH-23, 10 μM, Santa Cruz).
Michelucci A., Bithell A., Burney M.J., Johnston C.E., Wong K.Y., Teng S.W., Desai J., Gumbleton N., Anderson G., Stanton L.W., Williams B.P, & Buckley N.J. (2015). The Neurogenic Potential of Astrocytes Is Regulated by Inflammatory Signals. Molecular Neurobiology, 53(6), 3724-3739.
+ Open protocol
+ Expand
2

Pharmacological Reagents for Research

Check if the same lab product or an alternative is used in the 5 most similar protocols
D-Methamphetamine (D-meth), L-methamphetamine (L-meth), L-cycloserine, myriocin, thalidomide, cimetidine, quinidine, SKF-525A and clotrimazole were purchased from Sigma Aldrich (St. Louis, Missouri). Fumonisin B1 (FB1), C6 and C8 ceramide, and HET-0016 were from Cayman Chemicals (Ann Arbor, Michigan). 5′-aminosalicylic acid and JSH-23 were from Santa Cruz Biotechnology (Santa Crux, CA).
Astarita G., Avanesian A., Grimaldi B., Realini N., Justinova Z., Panlilio L.V., Basit A., Goldberg S.R, & Piomelli D. (2015). Methamphetamine Accelerates Cellular Senescence through Stimulation of De Novo Ceramide Biosynthesis. PLoS ONE, 10(2), e0116961.
+ Open protocol
+ Expand
3

Inhibition of Epigenetic Regulators in Cell Signaling

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The inhibitors included 20μM C646 (Santa Cruz Biotechnology, Dallas, Texas). It is an inhibitor of p300 induced histone acetylation (29 (link), 30 (link)). 20μM iBET151 (Life science Research, Billerica, Massachusetts) was used at as a specific inhibitor of BRD3/4, important for transcriptional activation and elongation at paused genes (31 (link)). 40μM DRB (Sigma-Aldrich, Allentown, PA ) was used as an inhibitor of elongation regulating eviction of NELF via P-TEFb (32 (link)). 20μM JSH-23 (Santa Cruz Biotechnology) was used as a specific inhibitor of NFκB translocation (33 (link)) and 10μM IT901 (Bio-Techne, Minneapolis, MN) was used as a specific antagonist of p65 NFκB (34 (link)). 10μM SP600125 (Calbiochem, Darmstadt, Germany) was used as an inhibitor of the JNK MAP kinase. Toxicity analyses confirmed minimal cell death at these concentrations. HPLC-purified LPS was purchased from Sigma-Aldrich (St. Louis, MO).
Shi L., Song L., Maurer K., Dou Y., Patel V.R., Su C., Leonard M.E., Lu S., Hodge K.M., Torres A., Chesi A., Grant S.F., Wells A.D., Zhang Z., Petri M.A, & Sullivan K.E. (2020). IL-1 transcriptional responses to LPS are regulated by a complex of RNA-binding proteins. Journal of immunology (Baltimore, Md. : 1950), 204(5), 1334-1344.
+ Open protocol
+ Expand
4

Antibody Characterization and NF-κB Inhibition

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies against phospho-IκBα, phospho-IRF3, NEDD8, and UBA3 were purchased from Cell Signaling Technology (Beverly, MA, USA). Antibodies against IκBα and actin and NF-κB inhibitor JSH-23 (dissolved in dimethylsulphoxide, DMSO) were purchased from Santa Cruz (Santa Cruz, CA, USA). Antibody against p65 was from Epitomics (Burlingame, CA). Antibody against IRF3 was from Abclonal (Cambridge, MA, USA). FBS was from HyClone Laboratories (Logan, UT, USA). M-CSF was from Cetus (Emeryville, CA, USA). TRIzol reagent, Moloney murine leukemia virus reverse transcriptase, and oligo(dT) primer were from Invitrogen (Carlsbad, CA, USA).
Zhang X., Ye Z., Pei Y., Qiu G., Wang Q., Xu Y., Shen B, & Zhang J. (2015). Neddylation is required for herpes simplex virus type I (HSV-1)-induced early phase interferon-beta production. Cellular and Molecular Immunology, 13(5), 578-583.
+ Open protocol
+ Expand
5

Inhibition of NF-κB Signaling in Cryptosporidium parvum Infection

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
C. parvum oocysts of the Iowa strain were purchased from a commercial source (Bunch Grass Farm, Deary, ID). Murine intestinal epithelial cell line (IEC4.1) was a kind gift from Dr. Pingchang Yang (McMaster University, Hamilton, Canada) and muINTEPI, a murine intestinal epithelial cell line (19 (link)), was purchased from InSCREENeX Cellular Screening Technologies (Germany). SC-514 (100 μM, Calbiochem), a potent IKK-2 inhibitor (20 (link)), and JSH-23 (Santa Cruz Biotechnology, Dallas, TX), a cell-permeable, selective inhibitor of nuclear translocation of NF-кB p65 and its transcription activity (21 (link), 22 (link)), were used to inhibit NF-кB activation. The phosphorothioate oligodeoxynucleotide (ODN), CpG-ODN 1668 (TCCATGACGTTCCTGATGCT), was purchased from Invitrogen (Carlsbad, CA). Lipopolysaccharide (LPS, from E. coli strain K12) was purchased from Invitrogen (San Diego, CA) and IFN-γ and TNF-α were purchased from R&D Systems (Minneapolis, MN). SC-514, TNF-α, IFN-γ and LPS at the utilized concentrations showed no cytotoxic effects on IEC4.1 and muINTEPI cells.
Li M., Gong A.Y., Zhang X.T., Wang Y., Mathy N.W., Martins G.A., Strauss-Soukup J.K, & Chen X.M. (2018). Induction of a long non-coding RNA transcript, NR_045064, promotes defense gene transcription and facilitates intestinal epithelial cell responses against Cryptosporidium infection. Journal of immunology (Baltimore, Md. : 1950), 201(12), 3630-3640.
+ Open protocol
+ Expand
6

NF-κB Pathway Activation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Dulbecco's modified Eagle's medium was purchased from Gibco (Grand Island, NY, USA). Fetal bovine serum was from Sijiqing (Hangzhou, Zhejiang, China). Penicillin, streptomycin, and nuclear and cytoplasmic extraction kit were from Shenggong (Shanghai, China). Abs to phospho-IκB-α, IκB-α, NF-κB-p65, β-actin, and JSH-23 were all from Santa Cruz (Santa Cruz, CA, USA). PDTC, MG-132, BAY 11-7082, BCA protein assay kit, nitric-oxide synthase assay kit, and abs to histone H3 were from Beyotime (Nantong, Jiangsu, China). Abs specific to mouse TLR4 was from eBioscience (San Diego, CA, USA). LPS, o-phenylenediamine, fluoresceinamine (FLA), and 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) were from Sigma-Aldrich (St. Louis, MO, USA). Enhanced chemiluminescence (ECL) substrate was from Thermo Scientific.
Zhou Y., Chen S., Ding R., Yao W, & Gao X. (2014). Inflammatory Modulation Effect of Glycopeptide from Ganoderma capense (Lloyd) Teng. Mediators of Inflammation, 2014, 691285.
+ Open protocol
+ Expand
7

Myeloid cell superoxide detection

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
O2•− producing MDRC were detected by flow cytometry after staining with myeloid cell-specific antibodies and incubation for 20 min at RT with dihydroxyethidium (DHE, 10 μM; Molecular Probes, Eugene, OR) as described before 32 (link). The specificity of DHE for O2•− was validated by inducing a respiratory burst in the sorted myeloid cells by incubation at 37°C for 15 min with phorbol myristate acetate (PMA, 1 μg/ml) or PMA + the NADPH oxidase inhibitor diphenylene iodonium (DPI, 1 μM; Tocris Bioscience, Bristol, UK) , in presence of superoxide dismutase (256mU/ml, Sigma, St. Louis, MO) or in presence or absence of 10μM Pyrrolidine dithiocarbamate (Calbiochem, La Jolla, CA) or in the presence or absence of 5 μM NF- κB activation inhibitor II, JSH-23 ( Santa Cruz Biotechnology, Santa Cruz, CA ).
Wang Y., Jin T.H., Farhana A., Freeman J., Estell K., Zmijewski J., Gaggar A., Thannickal V.J., Schwiebert L.M., Steyn A.J, & Deshane J.S. (2014). Exposure to cigarette smoke impacts myeloid-derived regulatory cell function and exacerbates airway hyper-responsiveness. Laboratory investigation; a journal of technical methods and pathology, 94(12), 1312-1325.
+ Open protocol
+ Expand
8

Murine Epicardial Cell Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse embryonic epicardial cell line MEC1 cells (gift from Dr. Hery Sucov lab, USC) were cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% FBS and penicillin/streptomycin (10μg/ml) in a 5% CO2 tissue culture incubator. JSH-23 (Santa Cruz, sc-222061) and BMS345541 (Millipore, 401480) were used at a final concentration of 8μmol and 6μmol, respectively. Recombinant TGFβ2 (Pepro Tech, 100-35B) and PDGFBB (Pepro Tech, 315–18) were used at a final concentration of 10ng/ml and 50ng/ml, respectively.
Li Y., Urban A., Midura D., Simon H.G, & Wang Q.T. (2017). Proteomic characterization of epicardial-myocardial signaling reveals novel regulatory networks including a role for NF-κB in epicardial EMT. PLoS ONE, 12(3), e0174563.
+ Open protocol
+ Expand
9

Myeloid cell superoxide detection

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
O2•− producing MDRC were detected by flow cytometry after staining with myeloid cell-specific antibodies and incubation for 20 min at RT with dihydroxyethidium (DHE, 10 μM; Molecular Probes, Eugene, OR) as described before 32 (link). The specificity of DHE for O2•− was validated by inducing a respiratory burst in the sorted myeloid cells by incubation at 37°C for 15 min with phorbol myristate acetate (PMA, 1 μg/ml) or PMA + the NADPH oxidase inhibitor diphenylene iodonium (DPI, 1 μM; Tocris Bioscience, Bristol, UK) , in presence of superoxide dismutase (256mU/ml, Sigma, St. Louis, MO) or in presence or absence of 10μM Pyrrolidine dithiocarbamate (Calbiochem, La Jolla, CA) or in the presence or absence of 5 μM NF- κB activation inhibitor II, JSH-23 ( Santa Cruz Biotechnology, Santa Cruz, CA ).
Wang Y., Jin T.H., Farhana A., Freeman J., Estell K., Zmijewski J., Gaggar A., Thannickal V.J., Schwiebert L.M., Steyn A.J, & Deshane J.S. (2014). Exposure to cigarette smoke impacts myeloid-derived regulatory cell function and exacerbates airway hyper-responsiveness. Laboratory investigation; a journal of technical methods and pathology, 94(12), 1312-1325.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!