Shrna2

Two short hairpin RNAs (shRNAs) specifically targeting the hTERT (shRNA1, GCATTGGAATCAGACAGCACT (sense), shRNA2, TGAGGCCTGAGTGAGTGTTTG (sense)), and a scramble shRNA (GACCTGTACGCCAACACAGTG (sense)) were synthesized by Genepharma (Shanghai, P. R. China). The hTERT shRNA and scramble shRNA sequences were each cloned into the pGCsilencer expressing plasmid (Genechem, Shanghai, P. R. China) and transiently transfected into CAPAN-2 and CAL-27 cells for 48 h using Lipofectamine 2000 reagent (Invitrogen, USA) following the manufacturer's instructions.

Rab7 shRNA1 (Genepharma), shRNA2 (Genepharma) or shRNA3 (Genepharma) was packaged. After that, lentiviral vector DNAs were transfected into 293T cells including NC and lenti-Rab7 shRNAs. The supernatant was collected after cell transfection. Then, supernatants of three Rab7 shRNAs and negative control were filtered into particles. HK-2 cells were infected with lentiviral particles. Puromycin (2.5 μg/mL, Sigma Aldrich) was used to select the stable cells after incubation. Western blot was used to assess the transfection efficiency.

An OGD/R model on the PC12 cell was used to mimic ischemic-like conditions in vitro. MiR-330-5p mimics for the overexpression of the miR-330-5p level or mimic control (miR-NC), ATP2B1-AS1 overexpression pcDNA3.1 vector (ATP2B1-AS1) or its control pcDNA3.1 vector (NC), as well as ATP2B1-AS1 knockdown vectors (shRNA#1, shRNA#2, shRNA#3) or its control vector (shNC) were designed and synthesized by GenePharma (Shanghai, China). The synthesized sequence was cloned into the plasmid vector pcDNA3.1. Briefly, the cells or the stably transfected cells with the specific vectors were cultured with a serum/glucose-free DMEM medium in a temperature-controlled (37°C) anaerobic chamber. After OGD exposure, the medium was replaced with normal DMEM containing glucose and FBS under a normoxic condition for 12, 24, and 48 h to reoxygenation. The LDH level and caspase-3 activity in the supernatant was determined by a commercial assay kit according to the instruction of the manufacturer.