Express sybr greener qpcrs supermix universal kit

Total RNA and enrichment of small RNA was isolated from fresh samples using the miRVana™ microRNA. Isolation Kit (Applied Biosystems/Ambion, Austin, TX,. USA) according to the manufacturer’s protocol and stored at −80 °C until use. Total RNA from fresh cultured cells was extracted with TRIzol reagent (Invitrogen, Carlsbad, California, USA). Real-time.
Real-time PCR was carried out using an Express SYBR® GreenER qPCRs supermix Universal kit (Invitrogen) on a Rotor-gene 6000 system (Qiagen, Valencia, CA, USA). USA). The relative amount of miR-124was normalized against U6 RNA. In current study, we calculated a ^ΔCt (target-reference) that is equal to the difference between threshold cycles for miR-124 (target) and those for U6 RNA.
The fold-change between cancer tissues and normal breast tissue control for miR-124 was calculated by the 2^ΔΔCt method, in which ^ΔΔCt = ^ΔCt (target-reference in tumor samples) - ^ΔCt (target-reference in normal samples). The relative expression levels of miRNAs in cancer compared to their non-tumorous controls were calculated using the method of 2^-ΔΔCt. The primers for miR-124 were used as follows: forward: 5′-GATACTCATAAGGCACGCGG-3′ and reverse: 5′-GTGCAGGGTCCGAGGT-3′.

Total RNA and enrichment of small RNA from fresh samples was isolated using the mirVana miRNA Isolation kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions, and then stored at -70°C until use. Total RNA from fresh cultured cells was carried out with TRIzol reagent (Invitrogen, Karlsruhe, Germany) following the manufacturer’s protocol. Real-time RT-PCR method was used to assess the expression levels of miR-124 with Express SYBR® GreenER qPCRs supermix Universal kit (Invitrogen) on a Rotor-gene 6000 system (Qiagen, Valencia, CA, USA). U6 RNA was used as an endogenous reference for normalizing the expression levels of miR-124. Initially, we calculated a ^ΔCt (target-reference), which is equal to the difference between threshold cycles for miR-124 (target) and those for U6 RNA (reference). The fold-change between cancer tissues and normal breast tissue control for miR-124 was calculated with the 2^ΔΔCt method, in which ^ΔΔCt = ^ΔCt (target-reference in tumor samples) - ^ΔCt (target-reference in normal samples). The relative expression levels of miRNAs in cancer compared to their non-tumorous controls were calculated using the method of 2^-ΔΔCt . The quantitative real-time PCR primers for miR-124 were designed as follows: forward: 5′‑GATACTCATAAGGCACGCGG‑3′ and reverse: 5′‑GTGCAGGGTCCGAGGT‑3′.

Total RNA and enrichment of small RNA was isolated from fresh samples using the miRVana™ microRNA. Isolation Kit (Applied Biosystems/Ambion, Austin, TX, USA) according to the manufacturer’s protocol. Moreover, we used TRIzol reagent (Invitrogen, Carlsbad, California, USA) to extracted total RNA from fresh cultured cells.
Real-time PCR was carried out using an Express SYBR® Green ER qPCRs supermix Universal kit (Invitrogen) by system of Rotor-gene 6000 (Qiagen). The relative amount of miR-148b was normalized with respect to U6 RNA. In current study, we used ^ΔCt method to calculate changes in expression. Moreover, 2ΔΔCt method was used to calculate the fold-change between cancer and normal tissue, that ^ΔΔCt = ^ΔCt (target-reference in tumor samples) - ^ΔCt (target-reference in normal samples). The miRNAs expression levels in cancer compared to non-tumorous controls that were also calculated using 2^-ΔΔCt method [14 (link)].