Phusion gc reaction buffer

T cells were pelleted and lysed in a buffer containing water, Phusion GC reaction buffer, and proteinase K (New England Biolabs). Sequences spanning each end of the TRC1-2 homology arms were amplified from the cell lysate by PCR using the following primers: for 5′ insertions, forward (GATAGACGCTGTGGCTCTGCATGAC) and reverse (GCCTGAGTGTAATCTCGACGTGTGG) and for 3′ insertions, forward (GCTGCACATGCAAGCCTTACCACCTC) and reverse (GCGTACTTAGAATACTGTCTACCCTCTCATGGC). PCR reactions were performed containing 200 μM dNTP mix, Q5 reaction buffer, Q5 high GC enhancer, 0.5 μM of each primer, and Q5 hot start high-fidelity DNA polymerase (New England Biolabs). Both primer sets used the same PCR conditions as follows: 98°C for 4 min for initial denaturation, 30 cycles at 98°C for 10 s, 65°C for 20 s, 72°C for 1:35 min, and then a final elongation at 72°C for 5 min. PCR products were run on a 1.5% gel containing EtBr (VWR International) and visualized using a Fotodyne gel dock system.

T cells were pelleted and lysed in a buffer containing water, Phusion GC reaction buffer, and proteinase K (New England Biolabs). A sequence spanning the TRC1-2 target site was PCR-amplified from cell lysates using the following primers: TRC 1-2 forward (GAGCAGCTGGTTTCTAAGATGC) and TRC1-2 reverse (GGAGAGGCAACTTGGAGAAGG). The PCR was set up using 200 μM deoxynucleoside triphosphate (dNTP) mix, Q5 reaction buffer, Q5 high GC enhancer, 0.5 μM of each primer, and Q5 hot start high-fidelity DNA polymerase (New England Biolabs). PCR conditions were as follows: 98°C 4 min for initial denaturation, 35 cycles at 98°C for 10 s, 67°C for 20 s, 72°C for 31 s, and then a final elongation at 72°C for 5 min. A 25-μL aliquot of the PCR reaction was transferred to new tubes, and the DNA was denatured and slowly rehybridized to allow the formation of heteroduplex DNA sequences and then digested with 20 units of T7 endonuclease (New England Biolabs), which recognizes and cleaves heteroduplex DNA sequences. Digested products were run on 2% agarose gel containing EtBr (VWR) and visualized using a Fotodyne gel dock system.