Primescript rt kit

Total RNA was extracted using TRIzol reagent (Invitrogen). Lysates were mixed with chloroform and centrifuged at 12,000 g for 15 min at 4 °C. The upper aqueous phase was collected to a 1.5 ml tube, and an equal volume of isopropanol was added into it. cDNAs were synthesized using the Prime Script RT Kit (Promega; Madison, 498 WI, USA), according to the manufacturer's protocols. qRT-PCR analyses were performed using the SYBR Premix Ex Taq kit (Takara), employing GAPDH as an internal reference. The relative quantification values for RNAs were quantified using the 2^-ΔΔCt method. The prime sequences were listed in supplement Table S3.

Trizol reagent (Invitrogen, Carlsbad, CA) was used to extract the total RNA of cells and fresh tissues. PrimeScript RT kit (Promega, Madison, WI, USA) was used to synthesize cDNA. qPCR was performed in ABI7500 Real-time PCR system (Applied Biosystems, Foster City, USA) using SYBR PreMix ex Taq benchmark (Takala, Dalian, China) . The expression of related genes was measured by the comparative 2-ΔΔCT method. The sequence of primers used to amplify CSRP2 is 5'- TCACGATGAAGAGATCTACTGC -3' (forward) and 5(f AGTGTTTGGATTTGTTGTAGGC-3' (reverse). GAPDH was used as an endogenous control.

Total RNA was separated from tissues or cells with the TRIzol reagent (Invitrogen, Waltham, MA, USA). Nanodrop-spectrophotometer determined RNA concentration and purity. Then, the PrimeScRIPt-RT Kit (Promega, Madison, WI, USA) was utilized to transcribe 1 μg of RNA into DNA. Next, SYBR®Premix-Ex-Taq™ (Takara, TX, USA) and ABI7300 were employed for RT-qPCR. The total volume of the PCR system was 30 μL and 300 ng of cDNA was included in each sample. The amplification was performed with an initial denaturation at 95° C for 10 minutes, with 45 cycles. All fluorescence data were quantified relatively. U6 was the endogenous control of miR-30b-5p, and GAPDH was that of SIRT1, IL-1β, IL-6, TNF-α, IL-18, and FoxO3a. RT-qPCR was conducted in triplicate. Guangzhou Ribo Biotechnology Co., Ltd., China synthesized the primers (Table 1).

Total RNA for cell lines and tissue samples was isolated using Trizol reagent (Invitrogen; Thermo Fisher Scientific, USA). Then cDNA was synthesized using Prime-Script RT Kit (Promega Corporation, Madison, USA) for reverse transcription and Promega SYBR-Green PCR Master Mix (Promega Corporation, Madison, USA) for qRT-PCR on Roche LightCycler480 II real-time PCR system (Roche, Germany). The values of Ct were calculated with the 2−ΔΔCt method and normalized to the expression levels of β-actin. All PCR tests were conducted at least three times. The primer sequences used in this study are shown in Table S2.

The Trizol reagent (Invitrogen, USA) was used for total RNA extraction from tissues and cell lines following the manufacturer’s instructions. cDNA synthesis was carried out by RNA reverse transcription using PrimeScript RT kit (Promega Corporation, Madison, WI, USA). RT-qPCR (Roche, Germany) was performed on the Roche LightCycler480 II system according to the instructions of Promega SYBR-Green PCR Master Mix (Promega Corporation, Madison, WI, USA). The determination was carried out on a 96-wells plate, and each sample had three duplicate holes. GAPDH was used as the internal reference gene, and the relative expression level of mRNA was calculated using 2^-ΔΔCT method. The primer sequence of RT-qPCR is shown in Supplementary Table 3.

Extraction of total RNA was from tissues or cells via TRIzol reagents (Invitrogen, Waltham, MA, USA). Detection of the concentration and purity of RNA was via nano-droplet spectrophotometer. With the instructions, reverse transcription of 1 μg total RNA was via the PrimeScript RT kit (Promega, Madison, WI, USA) and synthesis of its complementary DNA (cDNA) was conducted. performance of RT-qPCR was via SYBR Premix Ex TaqTM kit (Takara, Otsu, Japan). The loading control of HIPK1 was glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and that of miR-30 c-5p was U6. The primers were synthesized by RiboBio (Guangzhou, China) [34 (link)].

Genes	Forward (5ʹ-3ʹ)	Reverse (5ʹ-3ʹ)
HIPK1	TCCCCATACTACGAGAAGGGT	ATGTCCCCACCCCTAGTACC
GAPDH	CATTCAAGACCGGACAGAGG	ACATACTGCACACCAGCATCACC
MiR-30 c-5p	GCGCGTGTAAACATCCTACACT	AGTGCAGGGTCCGAGGTATT
U6	GAAGCGCGGCCACGAG	AGTGCAGGGTCCGAGGTATT

Whole RNA was obtained from cultured cells and fresh tissue using Trizol Regent (Invitrogen, United States). cDNA was synthesized using PrimeScript RT Kit (Promega, Madison, Wisconsin, United States), and qRT-PCR was performed using SYBR premixed Ex-TAQ^TM(Dalian, China) on ABI 7500 real-time PCR system (Foster City applied Biological Systems, United States). GAPDH was an internal control. Determination of relative gene expression 2^–ΔΔCt method.