The largest database of trusted experimental protocols

7 protocols using mir 101 mimic

1

Transfection of miR-101 and ZEB2 in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
We obtained miR-101 mimic and miR-101 negative control from GenePharma (Shanghai, China), then termed miR-101 mimic as miR-101 and miR-101 negative control as miR-NC in a convenient way. The pcDNA3.1s including ZEB2-pcDNA3.1 (pc-ZEB2) and negative control pcDNA3.1 (pc-NC) were purchased from Ribobio (Guangzhou, China). In cell transfection, which was performed with Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, New Mexico, U.S.A.) according to the manufacturer’s instructions, we seeded cells in six-well plates and cultured them until 60–75% confluency was reached.
+ Open protocol
+ Expand
2

Modulation of Adriamycin Response in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Jurkat and HEK293 cell lines were purchased from the American Type Culture Collection (ATCC; Rockville, MD, USA), and cultured in RPMI-1640 medium (Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS; Gibco) at 37°C in a humidified atmosphere with 5% CO2. Adriamycin (ADM) was obtained from Sangon Biotech Co., Ltd., (Shanghai, China) and dissolved in phosphate-buffered saline (PBS). Cells were treated with 5 µg/ml adriamycin for 24 h. The cells were transfected with miR-negative control (NC), miR-101 mimic, miR-101 inhibitor, Notch1-pcDNA3.1 or pcDNA3.1 empty vector (Shanghai GenePharma, Co., Ltd., Shanghai, China) using Lipofectamine 2000 (Invitrogen, Waltham, MA, USA) following the manufacturer's protocols. After 6 h, the medium was replaced with fresh medium for further experiments.
+ Open protocol
+ Expand
3

Modulating miR-101 Expression In Vitro and In Vivo

Check if the same lab product or an alternative is used in the 5 most similar protocols
The miR-101-mimic, control-mimic, inhibitor and inhibitor-control were designed and synthesized by Shanghai GenePharma Co., Ltd. miRNA (~50 nM) was transfected using Lipofectamine™ 2000 (Invitrogen) as recommended by the manufacturer. After 48 h of transfection, total RNA was extracted and the efficiency of transfection was verified by reverse transcription-quantitative PCR (RT-qPCR). For in vivo chemosensitivity assays, miR-101 mimic, control-mimic, miR-101 inhibitor and inhibitor-control sequences were embedded into the lentiviral pGIPZ plasmid (Genechem, Inc.). HepG2 cells were subsequently infected with the lentiviruses and inoculated into mice to produce tumor xenografts after 24 h of transfection. miRNA sequences were as follows: miR-101 mimic sense, 5′-UACAGUACUGUGAUAACUGAA-3′ and antisense, 5′-CAGUUAUCACAGUACUGUAUU-3′; control-mimic sense, 5′-UUCUCCGAACGUGUCACGUTT-3′ and antisense, 5′-ACGUGACACGUUCGGAGAATT-3′; miR-101 inhibitor, 5′-UUCAGUUAUCACAGUAUGUA-3′; and inhibitor-control, 5′-CAGUACUUUUGUGUAGUACAA-3′.
+ Open protocol
+ Expand
4

PRDM16 3'UTR Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
miR-101 mimics and their associated control, and miR-101 inhibitors and their associated control were synthesized by GenePharma Co., Ltd. (Shanghai, China). To generate a luciferase reporter construct, we synthesized 54 bp from the 3′-UTR of the PRDM16 mRNA from a human genomic DNA sample (Invitrogen). This 3′-UTR region of PRDM16, which contains the predicted target sites for miR-101, was then subcloned downstream of the pMIR-REPORT miRNA expression reporter vector (Ambion, Shanghai, China). We also constructed plasmids with mutated miR-101 target sites. miR-101 mimics, miR-101 inhibitors and PRDM16 siRNA DNA samples were transfected using Lipofectamine 3000 (Life Technologies, Gaithersburg, MD, USA).
+ Open protocol
+ Expand
5

Overexpression of SNHG1 and miR-101 in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
pcDNA-SNHG1and miR-101 mimics were constructed and purchased from Shanghai GenePharma Co., Ltd.. Cells were transfected with 200 ng/well pcDNA-SNHG1, pcDNA empty vector and 50 nM miR-101 mimics (UACAGUACUGUGAUAACUGAA) and its scramble control (mimics-NC) (UCACAACCUCCUAGAAAGAGUAGA) using Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol when the confluence of the cells reached 70–80%. Then, cells were collected at 48 h after transfection for further use.
+ Open protocol
+ Expand
6

miR-101 Modulation and Rap1b Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols
miR-101 mimics, anti-miR-101 and their respective negative controls (miRNA mimic/inhibitor) were synthesized by Shanghai GenePharma Co., Ltd. The full length of Rap1b was subcloned into pcDNA3.1 to overexpress Rap1b, with empty pcDNA3.1 vector serving as the control. Transfection of the cells with the miR-101 mimics (10 nM), anti-miR-101 (10 nM), miRNA mimic/inhibitor (10 nM) and vectors (10 nM) were performed using Lipofectamine® 2000 (Thermo Fisher Scientific, Inc.). Co-transfection of the cells with miR-101 mimic and Rap1b was performed using Lipofectamine® 2000 (Thermo Fisher Scientific, Inc.), the subsequent experiments were performed at 48 h post-transfection. The sequences of oligonucleotides used were as follows: miR-101 mimics, 5′-UACAGUACUGUGAUAACUGAA-3′; miRNA mimics, 5′-UUUGUACUACACAAAAGUACUG-3′; anti-miR-101, 5′-UUCAGUUAUCACAGUACUGUA-3′ and miRNA inhibitor control, 5′-UCACAACCUCCUAGAAAGAGUAGA-3′.
+ Open protocol
+ Expand
7

Validation of miR-101 Target Sites

Check if the same lab product or an alternative is used in the 5 most similar protocols
MiR-101 mimics and their associated control and the miR-101 inhibitors and their associated control were synthesized by GenePharma Co., Ltd. (Shanghai, China). To generate a luciferase reporter construct, we synthesized 54 bp from the 3′-UTR of the LMO3 mRNA from human genomic DNA (Invitrogen). This 3′-UTR region of LMO3, which contains the predicted target sites for miR-101, was then subcloned downstream of the pMIR-REPORT miRNA expression reporter vector (Ambion, Shanghai, China). We also constructed plasmids with mutated miR-101 target sites. The MiR-101 mimics, siRNA and DNA plasmids were transfected using Lipofectamine 2000 (Life Technologies, Gaithersburg, MD, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!