Improm 2 reverse transcriptase

Manufactured by Promega

Sourced in United States, France, Japan, Germany, Italy, Switzerland, United Kingdom

The ImProm-II reverse transcriptase is a laboratory tool used for the conversion of RNA into complementary DNA (cDNA) molecules. It performs the essential function of reverse transcription, a critical step in various molecular biology techniques such as gene expression analysis and cDNA library construction.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Reverse transcriptase (278 citations) ImProm-II (157 citations) ImProm-II Reverse Transcriptase kit (82 citations) ImProm II Reverse Transcriptase system kit (12 citations) ImProm-II™ reverse (4 citations) ImProm-II Reverse transcriptase II (3 citations) ImProm-II Reverse Transcriptase cDNA Synthesis Kit (2 citations)

369 protocols using improm 2 reverse transcriptase

Quantitative Analysis of FCN3 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from lung tissues was extracted with TRI Reagent (Ambion, Austin, TX) and reverse transcribed using ImProm-II™ reverse transcriptase (Promega, Madision, WI) to synthesize cDNA. After amplification with Platinum-taq DNA polymerase (Invitrogen, Carlsbad, CA), FCN3 expression was analyzed by gel electrophoresis. For real-time RT-PCR analysis, total RNA was extracted using miRNeasy Mini kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol. cDNA was synthesized from 1 µg of total RNA using ImProm-II™ reverse transcriptase (Promega, Madison, WI). Approximately 5 ng of cDNA was subjected to PCR amplification using SYBR Select Master Mix (Applied Biosystems by Life Technologies, Austin, TX) on a CFX96 Real-time PCR detection system (Bio-Rad, Hercules, CA). ACTB and HPRT1 were used as dual internal reference genes. Oligonucleotide primers used for RT-PCR are listed in Supplementary Table 1.

Jang H., Jun Y., Kim S., Kim E., Jung Y., Park B.J., Lee J., Kim J., Lee S, & Kim J. (2021). FCN3 functions as a tumor suppressor of lung adenocarcinoma through induction of endoplasmic reticulum stress. Cell Death & Disease, 12(4), 407.

+ Open protocol

+ Expand

Total RNA Isolation and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cell culture using the TRIzol reagent (Life Technologies). Following which, 10 μg of the RNA was reverse transcribed to cDNA in a total volume of 100 μl with ImProm-II reverse transcriptase (RT) (Promega). The reaction conditions were as follows: 5 min incubation at 25 °C, 60 min at 42 °C, heating at 70 °C for 15 min. Finally, 2 μl of cDNA diluted with sterile deionized water was used in the PCR reaction.
The cDNA used in the microarray experiments was subjected to an additional hydrolysis stage (30 min at 65 °C) followed by neutralization and purification. More detailed information on the procedure is available upon request.

Nowakowska M., Pospiech K., Lewandowska U., Piastowska-Ciesielska A.W, & Bednarek A.K. (2014). Diverse effect of WWOX overexpression in HT29 and SW480 colon cancer cell lines. Tumour Biology, 35(9), 9291-9301.

+ Open protocol

+ Expand

RNA Extraction from B. licheniformis Cultures

Check if the same lab product or an alternative is used in the 5 most similar protocols

Aliquots (1 mL) from B. licheniformis B3-15 cultures in MGV or MGV-op, incubated at 45 °C, were collected at different times (12, 24, and 48 h) and centrifuged at 8000 rpm × 10 min. To obtain RNAs, the cells were treated with Trizol Reagent (Life Technologies, Carlsbad, CA, USA). To remove the traces of DNA, the samples were treated for 30 min at 37 °C with 1 U of RNase-free DNase (Promega Corporation, Madison, WI, USA). An RQ1 DNase stop solution (1 μL) was used to stop the reaction, and the sample was incubated at 65 °C for 10 min. A total of 1 μg of RNA, spectrophotometrically quantized, was used for the reverse transcription of complementary DNA (cDNA). An equal amount of RNA for each sample was reverse-transcribed into cDNA using Improm II reverse transcriptase (RT) (Promega Corporation, USA). The RT reaction was carried out at 25 °C for 5 min, then at 37 °C for 60 min and 70 °C for 15 min.

Zammuto V., Rizzo M.G., De Pasquale C., Ferlazzo G., Caccamo M.T., Magazù S., Guglielmino S.P, & Gugliandolo C. (2023). Lichenysin-like Polypeptide Production by Bacillus licheniformis B3-15 and Its Antiadhesive and Antibiofilm Properties. Microorganisms, 11(7), 1842.

+ Open protocol

+ Expand

Extraction and Quantification of Heart and Adipose RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from heart tissues was isolated using TRI Reagent (MRC; TR118). Total RNA from adipose tissues was isolated using RNeasy Mini Kit (74104, QIAGEN). Total cDNA was obtained by reverse transcription using Improm-2 reverse transcriptase (Promega; A3802) with oligo-dT primers. Real-time PCR was performed using the TaKaRa Real Time System, according to the manufacturer’s instructions, and SYBR Premix Ex Taq (Tli RNaseH Plus; TaKaRa; RR420A). The primer sequences are shown in S1 Table.

Kim J., Joo S., Eom G.H., Lee S.H., Lee M.A., Lee M., Kim K.W., Kim D.H., Kook H., Kwak T.H, & Park W.J. (2018). CCN5 knockout mice exhibit lipotoxic cardiomyopathy with mild obesity and diabetes. PLoS ONE, 13(11), e0207228.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Snail2 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

qPCR followed MIQE standards and as previously described (Flentke et al. 2011 ). Pooled RNA was isolated from 25 stage-matched headfolds (13–16 somite stage) at 18hr following in ovo alcohol or saline treatment, using the Ambion Melt Total Nucleic Acid Isolation kit. cDNA synthesis used the Improm2 reverse transcriptase (Promega, Madison WI). qPCR used the SYBR Select Master Mix (ABI, # 4472913) on the BioRad CFX96, and with the following protocol: preincubation 50°C 2 minutes, 95°C 2 minutes, 40–55 cycles of 95°C 15 seconds, 55°C 15 seconds, 72°C 45 seconds. Expression was normalized to GAPDH content, which is unaffected by alcohol in this model. Mean relative expression was calculated using the 2^-ΔΔCT method. Samples were run in triplicate and each gene was analyzed in at least three separate experiments. The Snail2 primers (XM_419196.6) generated a 137bp product and were: Forward 5’-CAGCGGTTCAGAAAGTCCCA; Reverse 5’-TGGCCAACCCAGAGAAAGTG. The GAPDH primers (M11213) generated a 189bp product and were: Forward 5’- CGTGTTGTGGACTTGATGGT; Reverse 5’- TGGAGGAAGAAATTGGAGGA. Primers were from IDT (Coralville, IA) and were chosen based on having an efficiency greater than 95%. Test and housekeeping genes were diluted to run within 3 Cqs of each other.

Flentke G.R., Baulch J., Berres M.E., Garic A, & Smith S.M. (2019). Alcohol-Mediated Calcium Signals Dysregulate Pro-Survival Snai2/PUMA/Bcl2 Networks to Promote p53-Mediated Apoptosis in Avian Neural Crest Progenitors. Birth defects research, 111(12), 686-699.

+ Open protocol

+ Expand

Quantitative Analysis of Murine Pai-1 mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA expressions of murine Pai-1 in the snap-frozen samples were assessed using quantitative PCR (qPCR). The amounts of target mRNA were quantified as described previously [16 (link)]. Total RNA (50 ng) was reverse transcribed using ImProm-II reverse transcriptase (Promega). The primers used for amplification of Pai-1 was 5′- GACACCCTCAGCATGTTCATC-3′ (forward primer) and 5′- AGGGTTGCACTAAACATGTCAG-3′ (reverse primer). The relative mRNA expressions of Pai-1 was normalized against that of the glyceraldehyde-3-phosphate dehydrogenase (Gapdh), gene in the same RNA preparation. qPCR was performed using SYBR Green qPCR Kits.

Imai J., Yahata T., Ichikawa H., Ibrahim A.A., Yazawa M., Sumiyoshi H., Inagaki Y., Matsushima M., Suzuki T., Mine T., Ando K., Miyata T, & Hozumi K. (2020). Inhibition of plasminogen activator inhibitor-1 attenuates against intestinal fibrosis in mice. Intestinal Research, 18(2), 219-228.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells or kidneys using the RNAspin Mini kit (GE Healthcare, #25-0500-72). Complementary DNA was obtained by reverse transcription of extracted RNA using Oligo(dT)₁₅ primers (Promega, #C1101) or Random Primers (Promega, #C1181) and ImProm-II Reverse Transcriptase (Promega, #A3802). Quantitative real-time PCR analysis was performed on technical duplicates using iTaq Univer SYBR Green (Bio-Rad Laboratories, #1725125) on CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories). Primer sequences for qRT–PCR are reported below:
mHprt fw5′-TTATGTCCCCCGTTGACTGA-3′
mHprt rev5′-ACATTGTGGCCCTCTGTGTG-3′
mAsns fw5′-GGTTTTCTCGATGCCTCCTT-3′
mAsns rev5′-TGTGGCTCTGTTACAATGGTG-3′

Steidl M.E., Nigro E.A., Nielsen A.K., Pagliarini R., Cassina L., Lampis M., Podrini C., Chiaravalli M., Mannella V., Distefano G., Yang M., Aslanyan M., Musco G., Roepman R., Frezza C, & Boletta A. (2023). Primary cilia sense glutamine availability and respond via asparagine synthetase. Nature Metabolism, 5(3), 385-397.

+ Open protocol

+ Expand

Quantifying Gene Expression in Late Instar Drosophila

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared from two biological replicates of 50 third instar males using Trizol reagent (Invitrogen). One microgram of total RNA was reverse transcribed using ImProm-II reverse transcriptase following manufacturer recommendations (Promega). Duplicate reactions were amplified using iTaq Universal SYBR Green Supermix (Bio-Rad) with an Mx3000P Real-Time PCR system (Stratagene). The genes analyzed were stably expressed in late third instar larvae. Gene and primer information is available upon request. Values were normalized to Dmn and expression calculated using the efficiency corrected comparative quantification method [46 (link)].

Joshi S.S, & Meller V.H. (2017). Satellite repeats identify X chromatin for dosage compensation in Drosophila melanogaster males. Current biology : CB, 27(10), 1393-1402.e2.

+ Open protocol

+ Expand

ICOV N Protein Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peritoneal macrophages were harvested, and total RNA was obtained with the Direct-zol RNA MiniPrep Plus kit (Zymo). First-strand cDNA synthesis was performed in a reaction containing Improm-II Reverse Transcriptase (Promega), a mix of dNTPs, and random primers (Promega), as described by the manufacturer. RT-PCR was performed using primers for the N protein gene of ICOV (sense 5’-AGGTGAGGCTGTAAATCTTG-3’ and antisense 5’-TCACATCATCCTTCCAAGTG-3’) or for the GAPDH gene (sense 5’-TTGACCAACTGCTTAGC-3’ and antisense: 5’-GGCATGGACTGTGGTCATGAG-3’), 2.5 U of GoTaq DNA polymerase (Promega), and 1.5 mM MgCl₂ in an appropriate buffer at an annealing temperature of 48 °C and 40 amplification cycles. PCR products were separated on a 1.2% agarose gel, stained with ethidium bromide, and photographed in a UV transilluminator.

Rath C.T., Schnellrath L.C., Damaso C.R., de Arruda L.B., Vasconcelos P.F., Gomes C., Laurenti M.D., Calegari Silva T.C., Vivarini Á.D., Fasel N., Pereira R.M, & Lopes U.G. (2019). Amazonian Phlebovirus (Bunyaviridae) potentiates the infection of Leishmania (Leishmania) amazonensis: Role of the PKR/IFN1/IL-10 axis. PLoS Neglected Tropical Diseases, 13(6), e0007500.

+ Open protocol

+ Expand

Renal Gene Expression Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from the right kidneys of 5, 18 and 24 wk-old CY and NC mice using the TRIzol reagent (Invitrogen, Carlsbad, USA). Quantitative real-time RT-PCR was performed using the TaqMan system (Applied Biosystems, Warrington, UK) with cDNA amplification using ImProm II reverse transcriptase (Promega, Madison, USA) and specific assays for renin (Mm02342889_g1), angiotensinogen (Mm00599662_m1), ACE (Mm00802048_m1) and GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) (Mm99999915_g1) as control. Results were obtained with the ΔΔCt methodology and are expressed as arbitrary units (AU).

Fonseca J.M., Bastos A.P., Amaral A.G., Sousa M.F., Souza L.E., Malheiros D.M., Piontek K., Irigoyen M.C., Watnick T.J, & Onuchic L.F. (2014). Renal cyst growth is the main determinant for hypertension and concentrating deficit in PKD1-deficient mice. Kidney international, 85(5), 1137-1150.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!