Total RNA was extracted from mammary cells with an Aidlab Rneasy kit (Aidlab) and reverse-transcribed for cDNA synthesis using a PrimeScriptRT Reagent Kit with gDNA Eraser (Takara). The quantitative reverse transcription PCR was performed in triplicate (three reactions per RNA sample) using the Applied Biosystems 7500 real-time PCR system (Applied Biosystems). The 20 μl reaction included 50 ng of reverse transcription product, 40 nm of each forward and reverse primers (online Supplementary Table S3, designed by Primer 5 software (Premier Biosoft International)) and the SYBR Premix Taq (Takara). The running programme was one cycle of 95°C for 30 s plus forty cycles of amplification at 95°C for 5 s and 60°C for 34 s, followed by the melt curve of an additional 15 s at 95°C, 1 min at 60°C and 15 s at 95°C. The relative mRNA abundance of target genes was normalised to the expression levels of ribosome protein 9 and β-actin and calculated by the 2−ΔΔCt method(36 ).
Sybr premix taq
Manufactured by Takara Bio
Sourced in Japan, United States, China
SYBR Premix Taq is a ready-to-use master mix for real-time PCR amplification. It contains SYBR Green I dye, hot-start Taq DNA polymerase, and necessary buffer components for reliable and efficient quantification of DNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (12 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (4 mentions)
Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (3 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Primescript rt reagent, by Takara Bio (3 mentions)
Abi 7300 real time system, by Thermo Fisher Scientific (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Primer 5, by Premier Biosoft (2 mentions)
Sv total rna isolation kit, by Promega (2 mentions)
Rnaiso plus, by Takara Bio (2 mentions)
Abi prism 7500 detection system, by Thermo Fisher Scientific (2 mentions)
M mlv reverse transcriptase, by Takara Bio (2 mentions)
Nanodro2000c, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (2 mentions)
Anti brdu antibody, by Merck Group (1 mentions)
Anti gapdh, by Santa Cruz Biotechnology (1 mentions)
Anti erk1 2, by Santa Cruz Biotechnology (1 mentions)
Anti p erk1 2, by Santa Cruz Biotechnology (1 mentions)
Anti bcl 2, by Santa Cruz Biotechnology (1 mentions)
Anti p akt, by Santa Cruz Biotechnology (1 mentions)
24 protocols using sybr premix taq
1
Quantitative RT-PCR of Mammary Cell RNA
2
Quantitative Real-Time PCR Analysis of Lung Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the lung sample by homogenization using RNA Iso plus (Takara, Shiga, Japan) and SV total RNA isolation kit (Promega, Madison, WI) and reverse transcribed as previously described [24 (link)]. Real-time PCR was performed using real-time PCR DICE and SYBR premix Taq (Takara Bio, Shiga, Japan). To calculate the relative mRNA expression level, the expression of each gene was normalized to that of the reference gene (GAPDH). The primers for real-time RT-PCR were as follows.
Chst3; forward; 5′-TGTTCCTGGCATTTGTGGTCATA-3′,
reverse: ′-CCAACTCGCTCAGGGACAAGA-3′,
TNF-α; forward; 5′- ATGGCCCAGACCCTCACA-3′,
reverse: 5′- GGAGTAGACAAGGTACAACCCATC-3′,
MMP-9; forward; 5′- CCATGCACTGGGCTTAGATCA-3′,
reverse: 5′- GGCCTTGGGTCAGGCTTAGA-3′,
Gapdh; forward; 5′- TGTGTCCGTCGTGGATCTGA-3′,
reverse: 5′- TTGCTGTTGAAGTCGCAGGAG-3′,
Chst3; forward; 5′-TGTTCCTGGCATTTGTGGTCATA-3′,
reverse: ′-CCAACTCGCTCAGGGACAAGA-3′,
TNF-α; forward; 5′- ATGGCCCAGACCCTCACA-3′,
reverse: 5′- GGAGTAGACAAGGTACAACCCATC-3′,
MMP-9; forward; 5′- CCATGCACTGGGCTTAGATCA-3′,
reverse: 5′- GGCCTTGGGTCAGGCTTAGA-3′,
Gapdh; forward; 5′- TGTGTCCGTCGTGGATCTGA-3′,
reverse: 5′- TTGCTGTTGAAGTCGCAGGAG-3′,
3
Investigating SKA1 and Apoptosis Pathways
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent and Lipofectamine 2000 were purchased from Invitrogen (Carlsbad, CA, USA). The First Strand cDNA Synthesis kit and SYBR Premix Taq were from Takara (Dalian, Liaoning, China). 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT), bromodeoxyuridine (BrdU) and the anti-BrdU antibody were purchased from Sigma (St. Louis, MO, USA). DAPI, BCA protein assay and ECL Plus kits were obtained from Beyotime Institute of Biotechnology (Beijing, China). BD BioCoat Matrigel invasion chambers were purchased from BD Biosciences (San Jose, CA, USA).
The primary antibodies against human SKA1 and cleaved caspase-3 were obtained from Abcam (Cambridge, MA, USA). Anti-Bcl-2, anti-Bax, anti-p-ERK1/2, anti-ERK1/2, anti-p-Akt, anti-Akt, anti-p21, anti-cyclin D1 and anti-GAPDH were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The horseradish peroxidase-conjugated anti-rabbit and anti-mouse IgG secondary antibodies were purchased from Santa Cruz Biotechnology. Biotinylated- and Cy3-conjugated anti-rabbit secondary antibodies were purchased form Boster (Wuhan, Hubei, China).
The primary antibodies against human SKA1 and cleaved caspase-3 were obtained from Abcam (Cambridge, MA, USA). Anti-Bcl-2, anti-Bax, anti-p-ERK1/2, anti-ERK1/2, anti-p-Akt, anti-Akt, anti-p21, anti-cyclin D1 and anti-GAPDH were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The horseradish peroxidase-conjugated anti-rabbit and anti-mouse IgG secondary antibodies were purchased from Santa Cruz Biotechnology. Biotinylated- and Cy3-conjugated anti-rabbit secondary antibodies were purchased form Boster (Wuhan, Hubei, China).
4
Quantification of mRNA Expression Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hrd1, CD19, CD20, CD138 and B-cell activating factor (BAFF) mRNA expression levels were evaluated by using qRT-PCR analysis as previously described.20 (link)21 (link) Briefly, total RNA was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's instructions. Reverse transcription was performed, in which cDNA for quantitative PCR was synthesized from 2 μg of total RNA using an oligo (dT) 18 primer and M-MLV reverse transcriptase (Takara, Dalian, China). RNA integrity and the success of the reverse transcription reaction were monitored by PCR amplification of β-actin transcripts. Messenger RNA expression was determined by using an ABI PRISM 7500 Detection System (Applied Biosystems, Foster City, CA, USA) with SYBR Premix Taq (Takara). The primer sequences for each gene are listed in Supplementary Table S2 . The qRT-PCR amplification protocol consisted of 40 cycles of a denaturation step at 95°C for 15 seconds and an annealing/extension cycle at 60°C for 45 seconds. Melting curve analysis was used to control for amplification specificity. The mean cycle threshold (Ct) values were normalized to those of β-actin, and the relative mRNA levels of the target genes were analyzed using the 2−△△Ct method. Experiments were performed in triplicate for each data point.
5
Real-Time PCR Analysis of NDUFS3 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from L-02 hepatocytes treated with different concentrations of Cr (VI) using the RNeasy Mini Kit (QIAGEN, Hilden, Germany). Then the total RNA (5 μg) from each treatment group was reverse-transcribed by the PrimeScript RT reagents kit (Takara, Dalian, China) according to the standard protocol. cDNAs were analyzed immediately for Real-time PCR assay using SYBR®Premix Taq™ (Takara, Dalian, China) with Applied Biosystems 7900HT Fast Real-Time PCR System (Applied Biosystems, Inc., Foster City, CA, USA) to observe the mRNA levels of targeted genes. The primer sequence of MRCC I [NADH dehydrogenase [ubiquinone] iron-sulfur protein 3 (NDUFS3)]: 5′- atgttgcccaaactggtctc −3 (forward primer), 5′- tcactgccttcccagagagt −3′ (reverse primer).
6
RNA Isolation and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated by TRIzol reagent in accordance with the manufacturer’s protocol. cDNAs were synthesized with the PrimeScript RT-PCR Kit (TaKaRa). The real-time polymerase chain reaction (RT-PCR) was carried out with SYBR Premix Taq (Takara) and performed on an ABI PRISM 7500 Detection System (Applied Biosystems, Foster City, CA, USA). Gene expression analysis was normalized to β-actin.
7
Chondrocyte Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After due treatment, total RNA was extracted from chondrocytes using TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. Then RNA was reverse transcribed to cDNA according to the manufacturer's protocols (Takara, Kyoto, Japan). RT-PCR was subsequently performed using SYBR® Premix Taq (Takara) and a Thermal Cycler Dice real-time TP800 system (Takara). The primers of Collagen II (COL2), Aggrecan, matrix metalloproteinase (MMP) 13, and a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS) 5 were listed in Table 1 . The targeted genes were analyzed by the 2-ΔΔCt method and GAPDH was used as a reference gene.
8
Quantitative Analysis of mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA containing mRNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instructions. cDNA was synthesized with the PrimeScript RT reagent Kit (TaKaRa Otsu, Shiga, Japan). qRT‐PCR analyses for mRNA of interest were performed using SYBR Premix Taq (TaKaRa) as previously reported. GAPDH was identified as a suitable internal control for human cervical tissue samples. The primers used are shown in Table S2 .
9
Quantitative Assessment of SOCS3 and miR-92a in CRC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from CRC tissues and cells using the TRIzol reagent (Invitrogen) according to the manufacturers’ instructions. The quality of RNAs was tested via NanoDro 2000 c (Thermo Scientific, USA). Subsequently, 3 μg RNAs were utilized as templates to produce cDNA using PrimeScript RT Reagent (Takara, Dalian, China). The SOCS3 mRNA and miR-92a were detected by a SYBR Premix Taq (Takara). The PCR processes were completed on an ABI 7300 Real-Time system (Ambion, USA) with parameters of 95°C for 40 s, 40 cycles of 95°C for 25 s, 58°C for 40 s, and 72°C for 55 s. Primers are shown in Table 1 .
The sequences of primers for Realtime PCR
| GENE | Primers | |
|---|---|---|
| Forward (5ʹ-3ʹ) | Reverse (5ʹ-3ʹ) | |
| GAPDH | TGTTCGTCATGGGTGTGAAC | ATGGCATGGACTGTGGTCAT |
| MiR-92a | ACACTCCAGCTGGGTATTGCACTTGTCCCGG | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAGGCCG |
| SOCS3 | CTCTGACTCTACACTCGCC | TAGTCCCGAAGCGAAATCTC |
| CD133 | AGTCGGAAACTGGCAGATAGC | GGTAGTGTTGTACTGGGCCAAT |
| Sox2 | GCCGAGTGGAAACTTTTGTCG | GGCAGCGTGTACTTATCCTTCT |
| OCT4 | GGGAGATTGATAACTGGTGTGTT | GTGTATATCCCAGGGTGATCCTC |
| All R | CTCAACTGGTGTCGTGGA | |
| U6 | CTCGCTTCG GCAGCACA | AACGCTTCACGAATTTGCGT |
10
Knockdown of CHST15 in Colon Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CCD-18Co cells (human colon cell line) were purchased form ATCC (USA). The concentrations of CHST15 siRNA and negative control siRNA used were 5 pM, 50 pM, 500 pM, 5 nM and 50 nM. Five hundred μL/well of Opti-MEMl (GIBCO), siRNA and 7.5 μL/well of RNAiMAX-Reagent (Invitrogen) were incubated on a 6-well plate at room temperature for 20 minutes. CCD-18Co cells (250,000 cells) were suspended in 2.5 mL of the basic culture medium in a CO2 incubator for 48 hours (2.5 mL/well). Culture supernatant was tested for IL-6 concentration (R&D systems). Total RNA was extracted from each transfected cell using a FastPure RNA kit (TaKaRa, Japan) according to the manufacturer’s instructions. Further, cDNA was synthesized and real-time RT-PCR was performed using SYBR premix Taq (TaKaRa). The expression of the human CHST15 gene was normalized by the expressed amount of RNA of human GAPDH. In separate series of experiments using CCD18-Co cells and human colon cancer cell line (HCT116) cells, the above experiments were performed in the presence of recombinant TGF-ß1 (10 ng/mL) for 48 h.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!