ApcMin/+ (C57BL/6J) mice were developed by Jackson Laboratories (Bar Harbor, Maine, USA). In this study, C57BL/6J mice were purchased from Japan SLC (Shizuoka, Japan) and sacrificed by cervical dislocation immediately before experiments. All animal experiments conformed to the Guide for the Care and Use of Laboratory Animals and were approved by the Institutional Committee of Laboratory Animal Experimentation and Research Ethics Committee of Nagasaki International University. This article does not contain any experiments with human subjects performed by any of the authors. Mice were maintained under specific pathogen-free conditions in the animal experimentation facility at Nagasaki International University, with temperature and lighting controlled throughout the experimental period. Mice were provided with food and water ad libitum.
C57bl 6j apcmin mice
Manufactured by Jackson ImmunoResearch
Sourced in United States
C57BL/6J-ApcMin/+ mice are a genetically engineered mouse model that carries a mutation in the Apc gene. These mice are commonly used in research related to intestinal cancer and colon polyp development.
Automatically generated - may contain errors
Lab products found in correlation
C57bl 6j mice, by Japan SLC (1 mentions)
5 asa, by Merck Group (1 mentions)
Phospho erk, by Cell Signaling Technology (1 mentions)
β catenin, by Cell Signaling Technology (1 mentions)
Smz645 microscope, by Nikon (1 mentions)
C57bl 6j mice, by Jackson ImmunoResearch (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Bdf 1 mice, by CLEA Japan (1 mentions)
D12492, by Research Diets (1 mentions)
Lgr5 egfp ires creert2 mice, by Jackson ImmunoResearch (1 mentions)
C57bl 6n mice, by Orient Bio (1 mentions)
19 protocols using c57bl 6j apcmin mice
1
Apc(Min/+) Mice for Cancer Research
2
ApcMin/+ Mice for Intestinal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ApcMin/+ C57BL/6J mice were obtained from the Jackson Laboratory and crossed into ApcMin/+ mice and wild-type littermates. All animals were kept under specific pathogen-free conditions in filter-top cages. Genotyping was performed at 4 weeks by PCR for AhRfl/fl mice and villin-CreER mice, as described previously 27 (link),28 (link). We subsequently crossed mice with a floxed AhR-/-Cre locus to ApcMin/+ mice to restrict AhR deficiency to ApcMin/+ mice.
In total, all the mice were obtained from Shanghai Super-B&K Animal Laboratory Co., Ltd. (Shanghai, China) with Certification No. SCXK 2016-0016. All animals were housed under specific pathogen-free conditions in accordance with the Chinese Experimental Animals Administration Legislation.
In total, all the mice were obtained from Shanghai Super-B&K Animal Laboratory Co., Ltd. (Shanghai, China) with Certification No. SCXK 2016-0016. All animals were housed under specific pathogen-free conditions in accordance with the Chinese Experimental Animals Administration Legislation.
3
UAT-B Impacts Intestinal Tumorigenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6J-APCmin/+ mice were obtained from Jackson Laboratory. Eight-week-old male mice of the same parental generation were divided into two groups that received 1 mg/kg UAT-B or vehicle via intraperitoneal injection every other day. The mice were sacrificed and tumors of longitudinal dissection of the small intestine and colon were imaged. Tumor numbers were calculated. Then, the small intestines and colons were sectioned and stained with immunohistochemistry. The survival time of mice after UAT-B treatment was recorded.
4
Generating Apc^Min/+;P-sel^-/- Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6J-ApcMin/+ mice were purchased from the Jackson Laboratory. Male ApcMin/+ mice were mated with female P-sel-/- mice on the C57BL/6J background to obtain ApcMin/+;P-sel+/- mice. To generate ApcMin/+;P-sel-/- mice, the ApcMin/+;P-sel+/- mice were backcrossed with P-sel-/- mice. Their genotypes were identified by PCR using the following primers: ApcMin/+, GCCATCCCTTCACGTTAG, TTCCACTTTGGCATAAGGC and TTCTGAGAAAGACAGAAGTTA; and P-selectin, CTGAATGAACTGCAGGACGA, ATACTTTCTCGGCAGGAGCA, TTGTAAATCAGAAGGAAGTGG and AGAGTTACTCTTGATGTAGATTCC.
5
Colorectal Adenoma Prevention in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The animal experiment was performed as reported earlier [9] (link). Briefly, 4–6 week old heterozygous female and male C57BL/6J-ApcMin/+ mice (Jackson Laboratories) were fed with either 2500 mg/kg 5-ASA (A3537, Sigma-Aldrich) mixed into the chow or with a control diet (C1000, Altromin). The 5-ASA dose corresponds to the intake of 3 g/day in humans [18] (link). After 12 weeks the mice were euthanized, the whole gut dissected and coiled up to a Swiss roll. The intestine was fixed in neutral buffered formalin (10%) for 24 h and embedded in paraffin.
6
ApcMin/+ Mice Dietary Intervention
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Eighteen male C57BL/6J ApcMin/+ mice (Jackson laboratories, Bar Harbor, ME, USA) were obtained at 5 weeks of age. Upon arrival, mice were acclimated for 24 h before being randomly assigned to treatment groups (n = 9/group). Dietary treatment lasted for 10 weeks, at which point mice were sacrificed, tumor and non-tumor intestinal tissues collected, and analyses performed. Mice were housed individually in microisolator cages in a room controlled for temperature (21 ± 1 °C), humidity, and light (12 h light:dark cycle). Mice consumed water and food ad libitum. Food intake and overall health were monitored once every three days, as fresh diet was provided and uneaten/spilled food was measured on the same schedule. Body weights were monitored weekly. All animal procedures followed the Institutional Animal Care and Use Committee procedures at Case Western Reserve University (CWRU), in accordance with the NIH guidelines.
7
Ginsenoside Effects on Apc^Min/+ Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Heterozygous male ApcMin/+ (C57BL/6J-ApcMin/+) mice were purchased from Jackson Laboratory. Mice were housed in a 12-h light–dark cycle facility and were fed with PicoLab®Rodent Diet 20-5053 (LabDiet, USA). All the mice had free access to food and water. Ginsenoside Rb3 (Purity 99.65%) and ginsenoside Rd (Purity 99.23%) were purchased from Man-Si-Te biological technological CO., Ltd (Chengdu, China). Rb3 and Rd were dissolved in 0.5% carboxymethyl cellulose (CMC). Total 32 male ApcMin/+ mice (aged 6 weeks) were divided into three groups; 10 mice in the control group and 22 mice equally divided for Rb3 and Rd treatments. The mice were daily gavage with a single dose of Rb3 or Rd at 20 mg/kg, or solvent control. The treatments were carried out for 8 consecutive weeks. The dosage was chosen based on our previous results and others published reports on the mouse dosages of ginsenosides. American Veterinary Medical Association guidance was followed for carbon dioxide based euthanasia. All the experimental processes were conducted within the approved guidelines of the Ethics Review Committee for Animal Research of Macau University of Science & Technology.
8
Evaluating Intestinal Polyp Formation in APC-Mutant Mice
9
Intestinal Adenoma Analysis in ApcMin Mice
10
Murine Intestinal Tumor Model Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6J and C57BL/6J-ApcMin/+ mice were obtained from The Jackson Laboratory. C57BL/6J/Sv129-M-lyslys-EGFP/lys-EGFP mice (18 (link)) were obtained from Albert Einstein College of Medicine. All mice were bred in-house, kept under isolator conditions at temperatures between 19 and 23°C on a 12-h light-dark cycle. They were pathogen-free by regular bacteriological and serological testing. Relative humidity was kept between 45 and 55%. The mice were fed on mouse complete maintenance diet with free access to food and water. For the experiments described here, the following mice were utilized: Apc+/+M-Lys+/+ (n=20), ApcMin/+M-Lys+/+ (n=23), Apc+/+M-Lyslys-EGFP/+ (n=9) And ApcMin/+M-Lyslys-EGFP/+ (n=12).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!