Proteins were detected using the following primary antibodies: anti-enterovirus VP1 clone 5-D8/1 antibody purchased from Dako (Denmark); Mouse anti-Ub, Mouse anti-MAT1, Mouse anti-CDK7, and Mouse anti-Cyclin H antibodies purchased from Santa Cruz (USA); Mouse monoclonal to RNA polymerase II CTD and Rabbit monoclonal to RNA polymerase II CTD (phosphor S5) antibodies purchased from Abcam (USA); Mouse anti β-actin purchased from Proteintech; Rabbit monoclonal CDK2 and CDK4, Rabbit monoclonal phosphor-CDK2 and CDK4, Mouse monoclonal pRb, Rabbit monoclonal pRb-phospho Ser780, pRb-phospho Ser795 and pRb-phospho Ser807/811 antibodies purchased from Cell Signaling (USA); Rabbit polyclonal Lamin B1, Mouse monoclonal c-Myc, Mouse monoclonal HA-Tag and Mouse Monoclonal Flag antibodies purchased from Sigma (USA); Goat anti-mouse IgG horseradish peroxidase-conjugated secondary antibody and goat anti-rabbit IgG horseradish peroxidase-conjugated secondary antibody purchased from Thermo Fisher Scientific (USA).
Mouse anti ub
Manufactured by Santa Cruz Biotechnology
Sourced in United States
The Mouse anti-Ub is a laboratory reagent that can be used for the detection of ubiquitin in biological samples. It is a monoclonal antibody raised in mice that specifically binds to ubiquitin, a small protein that plays a crucial role in cellular processes such as protein degradation and signaling.
Automatically generated - may contain errors
Lab products found in correlation
Cycloheximide (chx), by Merck Group (2 mentions)
Horseradish peroxidase conjugated goat anti rabbit igg secondary antibody, by Thermo Fisher Scientific (1 mentions)
Mouse anti β actin, by Proteintech (1 mentions)
Goat anti mouse igg horseradish peroxidase conjugated secondary antibody, by Thermo Fisher Scientific (1 mentions)
Mouse anti cdk7, by Santa Cruz Biotechnology (1 mentions)
Mouse anti vimentin, by Santa Cruz Biotechnology (1 mentions)
Polyvinylidene difluoride membrane, by GE Healthcare (1 mentions)
Ecl substrate, by GE Healthcare (1 mentions)
Mouse anti e cadherin, by BD (1 mentions)
Mouse anti α tubulin, by Merck Group (1 mentions)
Horseradish peroxidase conjugated anti rabbit or anti mouse secondary antibody, by Cell Signaling Technology (1 mentions)
Protease inhibitor cocktail, by Roche (1 mentions)
Mouse anti flag, by Abcam (1 mentions)
Rabbit anti snail, by Cell Signaling Technology (1 mentions)
Rabbit anti slug, by Cell Signaling Technology (1 mentions)
Mouse anti ha, by Abcam (1 mentions)
Mouse anti gfp, by Santa Cruz Biotechnology (1 mentions)
Rabbit anti ha, by Cell Signaling Technology (1 mentions)
Rabbit anti vsv g, by Merck Group (1 mentions)
Forskolin fsk, by Merck Group (1 mentions)
8 protocols using mouse anti ub
1
Comprehensive Protein Detection Methodology
2
Western Blot Analysis of Epithelial-Mesenchymal Transition Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Triton X‐100 lysis buffer [20 mm Tris (pH 7.4), 2 mm EDTA, 150 mm sodium chloride, 1 mm sodium deoxycholate, 1% Triton X‐100, 10% glycerol, 2 pills protease inhibitor cocktail (Roche)] was used to collect protein from cells. Protein samples were heat‐denatured and equally loaded, separated on 8–12% SDS/PAGE gel, transferred onto a polyvinylidene difluoride membrane (GE Healthcare, Buckinghamshire, UK), and blocked with 5% nonfat dry milk. Primary antibodies for western blot analyses included mouse anti‐α‐tubulin (1 : 20 000 dilution; Sigma), rabbit anti‐Snail (1 : 1000 dilution; Cell Signaling, Danvers, MA, USA), rabbit anti‐Slug (1 : 1000 dilution; Cell Signaling), rabbit anti‐CHIP (1 : 1000 dilution; Abgent, San Diego, CA, USA), mouse anti‐Flag (1 : 3000 dilution; Abcam), mouse anti‐GFP (1 : 1000 dilution; Santa Cruz), mouse anti‐HA (1 : 1000 dilution; Abcam, Cambridge, MA, USA), mouse anti‐Vimentin (1 : 1000 dilution; Santa Cruz, Santa Cruz, CA, USA), mouse anti‐E‐cadherin (1 : 5000 dilution; BD Biosciences, San Jose, CA, USA), and mouse anti‐Ub (1 : 5000 dilution; Santa Cruz). Membranes were incubated with horseradish peroxidase‐conjugated anti‐mouse or anti‐rabbit secondary antibody (1 : 5000 dilution; Cell Signaling) for 1 h, and chemiluminescence signals were detected by ECL substrate (GE Healthcare, Chicago, IL, USA).
3
Ubiquitin-Mediated Protein Regulation
4
Quantitative RT-PCR and Western Blot Analysis of Liver Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of liver tissues was isolated with the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Eight hundred nanograms total RNA was reverse-transcribed into cDNA using the PrimeScript RT reagent Kit (Takara, Tokyo, Japan) following the manufacturer’s instructions. The PCR amplification products were quantified by SYBR-green based qRT-PCR (Takara) following a standard procedure. The mRNA expression levels of target genes were normalized by β-Actin. Primer sequences are provided in Table 1 .
Primers Used for qRT-PCR
| Gene | Sequence 5′—3′ forward | Sequence 5′—3′ reverse |
|---|---|---|
| β-Actin | GTGACGTTGACATCCGTAAAGA | GCCGGACTCATCGTACTCC |
| Il-6 | GCTACCAAACTGGATATAATCAGGA | CCAGGTAGCTATGGTACTCCAGAA |
| Il-1β | TGTAATGAAAGACGGCACACC | TCTTCTTTGGGTATTGCTTGG |
| Tnfα | TTCTATGGCCCAGACCCTCA | TTTGCTACGACGTGGGCTAC |
| Dj-1 | GTGCAGTGTAGCCGTGATGT | CCTCCTGGAAGAACCACCAC |
5
Western Blot Analysis of Subcellular Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For Western blot analysis, cells were harvested and lysed in RIPA lysis buffer (Cell Signal Technology). To investigate subcellular distribution of proteins, nuclear and cytoplasmic fractions were enriched using Nuclear and Cytoplasmic Protein Extraction Kit (CoWin Bioscience). Western blot assays were followed according to an established protocol (20 (link)). Antibody used included mouse anti-GFP (Abmart), rabbit anti-acetyl Lysine (Abcam), rabbit anti-SUMO1 (Abcam), rabbit anti-Lamin B1 (Abcam), mouse anti-Ub (Santa Cruz), rabbit anti-USP49 (NOVUS), mouse anti-Flag (Proteintech), mouse anti-GAPDH (Thermo Fisher Scientific), mouse anti–β-tubulin (Thermo Fisher Scientific), rabbit anti-GRα (Abcam), rabbit anti-GRβ (Abcam). For protein stability detections, cells were treated with proteasome inhibitor MG132 (20 μmol/L, Sigma-Aldrich) for 6 hours or protein synthesis inhibitor Cycloheximide (CHX, 100 μg/mL, Sigma-Aldrich) for indicate time before harvest.
6
Antibody against SARS-CoV-2 N Protein Peptide
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PVM antibody against Cys-conjugated peptide SQQLNIVDDTPDDDI of the viral N protein sequence (residue 379–393)49 (link) was raised in rat commercially (Bio-Synthesis, Lewisville, TX). Primary antibodies used in immunoblot (IB or Western) and immunoprecipitation (IP) were: mouse anti-FLAG (Sigma, SLBF6631/F1804), rabbit anti-FLAG (Sigma, F7425), mouse anti-V5 (Thermo scientific, MA5–15253), rabbit anti-Myc (C-Myc) (Thermo scientific, PA1–981), mouse anti-Ub (Santa cruz, sc-8017), mouse anti-IκBα (Santa cruz, sc-56710), mouse anti-GAPDH (Santa cruz, sc-365062), mouse anti-β actin (Santa cruz, sc-81178), goat anti-RIGI (Santa cruz, sc-48929). The HRP-conjugated secondary antibodies were: goat anti-mouse (Santa cruz, sc-2031), goat anti-rabbit (Santa cruz, sc-2030), and mouse anti-goat (Santa cruz, sc-2354).
7
Western Blot Antibody Validation
8
Ubiquitination Analysis of GLI Transcription Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were transfected using lipofectamine 2000 according to the manufacturer's instructions. Forty‐eight hours after transfection, cells were harvested for immunoprecipitation and western blot analysis with standard protocols. To examine the ubiquitination levels of GLI2 and GLI3, A549 cells were transfected with Myc‐GLI2, HA‐GLI3 and different SPOP mutants. Before cell harvesting, the cells were treated by MG132 (50 mmol/L/mL) for 4 hours to prevent protein destabilization. Cells were first lysed by 100 mL denaturing buffer (1% SDS, 50 mM Tris, pH 7.5, 0.5 mmol/L EDTA and 1 mmol/L DTT) and incubated at 100°C for 5 minutes. The lysates were diluted with 900 mL lysis buffer and subjected to immunoprecipitation and western blot. The antibodies used for western blot analyses were as follows: mouse anti‐Fg (Sigma, Darmstadt, Germany); mouse anti‐ACTIN (Genscript, Corporation, Piscataway, NJ, USA); rabbit anti‐GLI1 (ABclonal, Woburn, MA, USA); rabbit anti‐PTCH1 (ABclonal); rabbit anti‐BCL2 (ABclonal); rabbit anti‐HHIP (ABclonal); rabbit anti‐AXIN2 (ABclonal); rabbit anti‐c‐Myc (ABclonal); rabbit anti‐CTGF (ABclonal); rabbit anti‐AREG (ABclonal); rabbit anti‐SPOP (ABclonal); mouse anti‐Myc (Santa Cruz Biotechnology, Santa Cruz, CA, USA); mouse anti‐HA (Santa Cruz); mouse anti‐Ub (Santa Cruz); goat antimouse HRP (Abmax) and goat anti‐rabbit HRP (Abmax, Beijing, China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!