Perfecthyb plus hybridization buffer

Manufactured by Merck Group

Sourced in United States

PerfectHyb Plus Hybridization Buffer is a laboratory reagent designed for use in nucleic acid hybridization assays. It provides optimized conditions for the formation of stable and specific hybridization complexes between probes and target sequences. The buffer composition ensures efficient and reproducible hybridization results.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (12 mentions) Trizol, by Thermo Fisher Scientific (9 mentions) Hybond n membrane, by GE Healthcare (8 mentions) Hybond n nylon membrane, by Cytiva (7 mentions) Hybond n membrane, by Cytiva (5 mentions) Storage phosphor screen, by GE Healthcare (4 mentions) T4 polynucleotide kinase, by Thermo Fisher Scientific (4 mentions) α 32p dctp, by PerkinElmer (3 mentions) Ultrapure bsa, by Thermo Fisher Scientific (3 mentions) Chemiluminescent nucleic acid detection module kit, by Thermo Fisher Scientific (3 mentions) 32p labeled decade marker, by Thermo Fisher Scientific (3 mentions) Imaging screen k, by Bio-Rad (3 mentions) Typhoon trio imaging system, by GE Healthcare (3 mentions) Typhoon fla 7000, by GE Healthcare (3 mentions) Zeta probe nylon membrane, by Bio-Rad (3 mentions) Amersham hybond nx nylon membrane, by GE Healthcare (2 mentions) Prime a gene labeling kit, by Promega (2 mentions) Phosphorimager, by GE Healthcare (2 mentions) Nylon membrane, by GE Healthcare (2 mentions) Nytran spc, by GE Healthcare (2 mentions)

Close spelling variants of this product

PerfectHyb Plus (27 citations) PerfectHyb buffer (16 citations) PerfectHyb Plus buffer (13 citations) Hybridization buffer (8 citations) PerfectHyb (8 citations) PerfectHyb hybridization buffer (4 citations) PerfectHyb™ Plus Hybridization Buffer liquid (2 citations)

100 protocols using perfecthyb plus hybridization buffer

Northern blot analysis of RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA samples were separated on 4% acrylamide gels containing 7 M urea in 0.5× TBE buffer and transferred to a Hybond N+ membrane by electrotransfer in 0.5× TBE buffer. After transfer, membranes were stained with 0.03% methylene blue in 0.3 M NaAc pH 5.3 for 5 min at RT, scanned, and then destained with water. RNA was immobilized on membranes by 254 nm UV light using a UVP CL-1000 crosslinker. Radioactive probes were labeled with an α³²P (dATP) with a DECAprime II DNA Labeling Kit (Thermo Fisher Scientific; AM1455). To obtain templates for probes labeling, PCR on cDNA from B cells activated with LPS and IL-4 for 7 days was conducted using primers listed in Supplementary Table 5. Alternatively, an oligo probe for U6 as a loading control was labeled with a γ³²P (ATP) with T4 PNK (NEB).
Membranes were pre-hybridized in PerfectHyb Plus Hybridization Buffer (Sigma, H7033) for 1 h 65 °C and incubated with radioactive probes in PerfectHyb Plus Hybridization Buffer overnight 65 °C (in case of oligo probe—at 37.5 °C). Then membranes were washed in 2× SSC with 0.1% SDS for 20 min, 0.5× SSC with 0.1% SDS for 20 min and 0.1× SSC with 0.1% SDS for 20 min, scanned with Fuji Typhoon FLA 7000 (GE Healthcare Life Sciences), and analyzed with Multi Gauge software V3.0 (Fujifilm).

Bilska A., Kusio-Kobiałka M., Krawczyk P.S., Gewartowska O., Tarkowski B., Kobyłecki K., Nowis D., Golab J., Gruchota J., Borsuk E., Dziembowski A, & Mroczek S. (2020). Immunoglobulin expression and the humoral immune response is regulated by the non-canonical poly(A) polymerase TENT5C. Nature Communications, 11, 2032.

+ Open protocol

+ Expand

Small RNA Fraction Enrichment and Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small RNA fraction was enriched from 200–400 μg of total RNA by incubation 30min on ice with 190 mM sodium chloride and 7.3% PEG 8000. The supernatant was carefully collected after centrifugation for 20 min at 15,500g at 4°C and ethanol- precipitated as described above. The pellet was washed with 95% ethanol, air-dried and resuspended in DEPC water. 5 μg of small RNA were denatured in 1X sample buffer (50% formamide, 2.5 mM EDTA, 0.01% blue bromophenol), electrophoresed on a 10% PAGE with 7 M urea at 225V in 1X TBE buffer (Sigma T4415) and transferred on a Hybond-XL membrane (GE RPN203S) by semi-dry transfer for 45 min at 3mA/cm² (Thermo Owl HEP Series Semidry Electroblotting System). Membrane was rinsed in 2X SSC before UV crosslinking for 30 s at 254nm (Vilbert Lourmat). For probe preparation, 20 pmol of 5′-unphosphorylated primer were 32P-labeled with 10 U of PNK (Promega M4101) and 2 μL of [Ɣ-32P]-ATP (Perkin NEG002A250UC) in a 20 μL- reaction for 60 min at 37°C. The probe was purified using ProbeQuantTM G-50 Micro Columns following the manufacturer’s instructions (GE 28–9034-08), denatured and hybridized to the crosslinked membrane overnight at 42°C in PerfectHybTM Plus Hybridization Buffer (Sigma H7033). The membrane was then washed in 2X SSC 0.1% SDS, twice in 0.1X SSC 0.1% SDS at 42°C and visualized with Super RX-N film (Fujifilm 47410 19289).

Finet O., Yague-Sanz C., Krüger L.K., Tran P., Migeot V., Louski M., Nevers A., Rougemaille M., Sun J., Ernst F.G., Wacheul L., Wery M., Morillon A., Dedon P., Lafontaine D.L, & Hermand D. (2021). Transcription-wide mapping of dihydrouridine reveals that mRNA dihydrouridylation is required for meiotic chromosome segregation. Molecular cell, 82(2), 404-419.e9.

+ Open protocol

+ Expand

Northern Blot Analysis of Small RNAs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

10 μg RNA from total extracts was denatured at 95ºC for 10 minutes in sRNA loading buffer [20 mM HEPES pH7.8, 1 mM EDTA, 50% formamide, 3% glycerol and 0.01% bromophenol blue (BPB)], and separated in a denaturing 18% polyacrylamide gel. The RNA was blotted on an Amersham Hybond-NX nylon membrane (GE Healthcare Life Sciences) and crosslinked by 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) for 2 h at 60ºC (39 (link)). Radioactively end-labeled probes were hybridized to the membrane in PerfectHyb^TM Plus Hybridization buffer (Sigma) at 42ºC overnight. Membranes were washed 3x with 2xSSC, 2% SDS at 42ºC for 15 minutes, and developed by phosphorimaging.

Branscheid A., Marchais A., Schott G., Lange H., Gagliardi D., Andersen S.U., Voinnet O, & Brodersen P. (2015). SKI2 mediates degradation of RISC 5′-cleavage fragments and prevents secondary siRNA production from miRNA targets in Arabidopsis. Nucleic Acids Research, 43(22), 10975-10988.

+ Open protocol

+ Expand

Northern Blot Analysis of RDV S2 and S11 RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Accumulation of RDV S2 and S11 genomic RNA was analyzed by Northern blot as described33 . Briefly, ten microgram total RNA from each assayed plant was transferred to a Hybond N⁺ nylon membrane (Amersham) after electrophoresis in a 1.2% (w/v) formaldehyde-denaturing agarose gel. Radioactive probes used for the detection were PCR products amplified with primer sets S2-F1/S2-R1 and S11-F1/S11-R1 (Table S1) and labeled with α−³²P-dCTP using the Random Primer DNA Labeling Kit Ver.2 (Takala). The hybridization was performed overnight in the PerfectHyb^TM Plus Hybridization Buffer (Sigma) at 65 °C. The blotted membrane was washed for 15 min in a 2 ×SSC solution containing 0.1% SDS at 65 °C followed by washing two times (15 min each) in a 0.1×SSC solution containing 0.1% SDS. The detection signal was monitored with a phosphorimager (GE, USA) and quantified using the ImageJ (version 1.44).

Hong W., Qian D., Sun R., Jiang L., Wang Y., Wei C., Zhang Z, & Li Y. (2015). OsRDR6 plays role in host defense against double-stranded RNA virus, Rice Dwarf Phytoreovirus. Scientific Reports, 5, 11324.

+ Open protocol

+ Expand

Quantitative Analysis of RNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were extracted using TRIzol reagent from the fourth and fifth true leaves from 24-day-old plants. RNA was quantified using NanoDrop, and approximately 1 µg total RNA was converted into cDNA using HiScript Q RT SuperMix (Vazyme, R123–01) for quantitative real-time PCR (qRT-PCR) according to the manufacturer instructions. 2 μL of the resulting 20 μL cDNAs was used for qRT-PCR analyses with the primers listed in Supplementary Table 2. The qRT-PCR reactions were performed using a CFX96 Real-time PCR Instrument (Bio-Rad) with SYBR^® Premix Ex Taq™ (Takara, RR420A). Three biological repeats were analyzed. qRT-PCR data were normalized to the ACTIN2 signals.
To analyze small RNAs, 20–30 μg of total RNAs was separated by electrophoresis on 15% polyacrylamide/7 M urea denaturing gels and transferred to nylon membrane (GE Health) for 1 h at 3.3 mA/cm² using semi-dry transfer unit (Bio-Rad). After cross-linking by UV irradiation, the membrane was hybridized in PerfectHyb^TM Plus hybridization buffer (Sigma-Aldrich, H7033) with biotin-labeled DNA probes complementary to the siRNA or miRNA sequences at 42 °C overnight. Detection of immobilized nucleic acids was performed using Nucleic Acid Detection Module Kit (Thermo Fisher, 89880). After stripping the probes, the same blots were reprobed with U6 probe that serves as a loading control.

Liu J., Feng L., Gu X., Deng X., Qiu Q., Li Q., Zhang Y., Wang M., Deng Y., Wang E., He Y., Bäurle I., Li J., Cao X, & He Z. (2019). An H3K27me3 demethylase-HSFA2 regulatory loop orchestrates transgenerational thermomemory in Arabidopsis. Cell Research, 29(5), 379-390.

+ Open protocol

+ Expand

Polysome Loading Protocol with Radioactive Probes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Polysome loading experiment was performed as described previously (Meurer et al., 2017 (link)). [γ-³²P]ATP 5′-end-labeled 80-mers were used as probes. Hybridization was performed with PerfectHybTM Plus Hybridization Buffer (Sigma) at 55°C for 3 h. Membranes were washed twice at 55°C for 5 min with buffer containing 1× SSC and 0.1% SDS.

DeTar R.A., Barahimipour R., Manavski N., Schwenkert S., Höhner R., Bölter B., Inaba T., Meurer J., Zoschke R, & Kunz H.H. (2021). Loss of inner-envelope K+/H+ exchangers impairs plastid rRNA maturation and gene expression. The Plant Cell, 33(7), 2479-2505.

+ Open protocol

+ Expand

Northern Blot Analysis of Transfected T. cruzi

Check if the same lab product or an alternative is used in the 5 most similar protocols

T. cruzi cytoplasmic RNA from each transfectant was isolated from epimastigotes in the logarithmic phase of growth by parasite lysis and phenol extraction as previously described [44 (link)]. For Northern blot analysis, 10 μg of purified RNA were size-fractionated on 1 % agarose/formaldehyde gels, and then transferred to Z-probe nylon membranes (Bio-Rad®) in a 10× SSC solution. Hybridization was performed as previously described [45 (link)] but using PerfectHyb^TM Plus Hybridization Buffer (Sigma®). The Luc and neo DNA hybridization probes were generated by PCR amplification using the LucFw (5′ CGCCATTCTATCCTCTAGAGGAT 3′) and LucRT (5′ CTCCGATAAATAACGCGCCC 3′) primers or neoFw (5′ GATCGGCCATTGAACAAGAT 3′) and neoRv (5′ ATACTTTCTCGGCAGGAGCA 3′) oligos, respectively and the pTEXLuc vector as a DNA template. The T. cruzi KMP11 coding sequence was also PCR-amplified using the K1Tc and K2Tc primers as previously described [45 (link)]. Luc and kmp11 DNAs were radiolabelled using [α-³²P]-dCTP (Perkin Elmer®) and the Random Primed Labelling System (Stratagene®). The hybridization products were visualized and quantified using a PhosphorImager (Thypoon, Pharmacia®). Quantification analyses were performed using ImageQuant software (Molecular Dynamics®).

Macías F., López M.C, & Thomas M.C. (2016). The Trypanosomatid Pr77-hallmark contains a downstream core promoter element essential for transcription activity of the Trypanosoma cruzi L1Tc retrotransposon. BMC Genomics, 17, 105.

+ Open protocol

+ Expand

RNA Cleavage Fragment Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For cleavage fragment analysis, 20 μg of total RNA was loaded onto a 1% denaturing agarose gel and separated for 3–5 h at 120V. The RNA was blotted to an Amersham Hybond-NX nylon membrane (GE Healthcare Life Sciences) and UV-crosslinked (254 nm). After pre-hybridization in PerfectHyb^TM Plus Hybridization buffer (Sigma) for 1 h at 65ºC, the radioactively labeled probe (Prime-a-gene labeling kit, Promega) was hybridized overnight at 65ºC. Sequences for primers used for amplification of probe templates for GFP and endogenous miRNA targets are listed in Supplementary Table S4. After hybridization, the membrane was washed 3 times in 2xSSC (0.3 M NaCl, 30 mM sodium citrate), 0.1% SDS at 65ºC and developed by phosphorimaging. For Terminator (Epicentre) reactions, 10 μg of total RNA was incubated with 1 U Terminator (Epicentre) for 1 h at 30ºC. The reaction was terminated by phenol extraction and subsequent ethanol precipitation. The RNA was resuspended in 50% formamide and loaded with untreated RNA as control on a 1% denaturating agarose gel. Poly(A) RNA was purified from 10 μg of total RNA using Dynabeads Oligo(dT)₂₅ (Life Technologies) according to the manufacturer's instructions.

+ Open protocol

+ Expand

Northern Blot Analysis of Rice RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was obtained from rice plants as described above. Northern blot analysis was performed as previously described [50 (link)]. RNA (8 μg per lane) was separated by electrophoresis on 1.2% (w/v) formaldehyde-denaturing agarose gels and blotted onto N+ nylon membrane (Amersham; Buckinghamshire, UK). The probes were amplified from PCR products with primers listed in S5 Table, and labeled using α-³²P-dCTP with the Random Primer DNA Labeling Kit (TaKaRa; Shiga, Japan). Hybridization and detection were performed according to instructions that came with the PerfectHybTm Plus Hybridization Buffer (Sigma).

Jin L., Qin Q., Wang Y., Pu Y., Liu L., Wen X., Ji S., Wu J., Wei C., Ding B, & Li Y. (2016). Rice Dwarf Virus P2 Protein Hijacks Auxin Signaling by Directly Targeting the Rice OsIAA10 Protein, Enhancing Viral Infection and Disease Development. PLoS Pathogens, 12(9), e1005847.

+ Open protocol

+ Expand

Small RNA Northern Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The rice plants of 30 seedlings showing typical disease symptoms were pooled at 3 wpi. Small RNAs were extracted using RNAzol®RT as instructed (Molecular Research Center, Inc. USA). Ten microgram small RNA from each sample was separated in a 15% denaturing polyacrylamide gel containing 8 M urea and transferred to a Hybond N+ nylon membrane (Amersham). Approximately 500 ng PCR product amplified with the S2-F1/S2-R1 or S11-F1/S11-R1 primer set (Table S1) and labeled with α−³²P-dCTP were used as the probes. Hybridization was performed overnight in the PerfectHyb^TM Plus Hybridization Buffer (Sigma) at 42 °C. The membrane was stripped with 0.1% SDS at 100 °C 10 min three times to remove S11 probe and hybridized with S2 probe.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!