Fluorescence in situ hybridization kit

CTNNB1 mRNA probes and the fluorescence in situ hybridization kit were purchased from RiboBio. The subcellular localization of CTNNB1 mRNA in PCa cells was detected by FISH according to the manufacturer’s instructions. In brief, the steps were as follows: [1 (link)] Fix with 4% paraformaldehyde for 10 min [2 (link)]. Permeabilize with 0.5% TritonX-100 for 5 min [3 (link)]. Prepare hybridization solution, hybridization solution I/II/III and pre-hybridization solution [4 (link)]. Add the pre-hybridization solution and block at 37 °C for 30 min [5 ]. Prepare the probe hybridization solution with the 37 °C-hybridization solution and CTNNB1 probe. Mix in set proportions [6 (link)]. Add the probe hybridization solution at 37 °C overnight in the dark [7 (link)]. Wash with hybridization solution 1/2/3 at 42 °C in sequence. [8 (link)] Block with 2% BSA for 1 h and immunofluorescence primary antibody at 4 °C overnight. [9 (link)] Incubate with fluorescent secondary antibody for 1 h at room temperature. [10 (link)] Add DAPI dropwise to cover the slides. Finally, the slides were photographed using a confocal laser scanning microscope (Leica, Germany).

RNA fluorescence in situ hybridization was performed using a fluorescence in situ hybridization kit (Ribobio Corporation, Guangzhou, China), following the manufacturer’s instructions, to determine the localization of lncRNA-FLORPAR in A7r5 cells. All the probes were labeled with CY3 fluorescent dye, and fluorescence detection was performed with a Zeiss LSM 800 confocal microscope.

Cy3-labeled BCRC-3 probe was bought from RiboBio. The assay was performed using fluorescence in situ hybridization kit (RiboBio, Guangzhou, China) according to the manufacturer’s instructions. The signal of the probes was detected by Nikon A1Si Laser Scanning Confocal Microscope (Nikon Instruments Inc., Japan).

FISH assays were employed using the Fluorescence In Situ Hybridization kit (RiboBio, Guangzhou, Guangdong, China). Cells were seeded on slides and fixed in 4% paraformaldehyde (PFA) at room temperature for half an hour. Then, cells were treated with 0.5% Triton X-100 on ice for 15 min to enhance membrane permeability. Subsequently, cells were mixed with hybridization buffer containing FISH probes for half an hour under 60°C. After washing off the residual reagent, the slides were dehydrated, and DAPI (Promega, Madison, WI, USA) was employed for staining nucleus. The laser-scanning confocal microscope was employed to observe images (Leica Microsystems, Germany).

Cy3-labled probes including circRHOBTB3 and 18 s and FAM-labled locked nucleic acid miRNA probes were designed and synthesized by RiboBio (Guangzhou, China) and GenePharm (Suzhou, China), respectively, and the probe sequences were obtained on request. The signals of the probes were detected by Fluorescence In Situ Hybridization kit (RiboBio, Guangzhou, China) according to the manufacturer instruction. The images were acquired on Nikon AISi Laser Scanning Confocal Microscope (Nikon instruments Inc., japan).

RNA-FISH was performed using a Cy3-labeled RNA probe for circRSU1 and a FITC-labeled RNA probe for miR-345-3p. The specific probes were as follows: circRSU1 (5′–3′ CY3 Labeled): TGGGATAAGGTAACTAGTTCTGGGG, miR-345-3p (5′–3′ FITC Labeled): CTCCAGACCCCTCGTTCAGG. Then signals were then detected with a fluorescence in situ hybridization kit (RiboBio) according to the manufacturer’s protocol. The cell nuclei were counterstained with DAPI. Fluorescence images were captured using a Zeiss LSM 800 microscope.

Cy3-labeled probe specific to cirPTCH1 was purchased from Ribobio (Guangzhou, China). Cell nuclei were stained with DAPI. The FISH experiment was performed using the Fluorescence in situ hybridization kit (C10910, Ribobio, Guangzhou, China) following the manufacturer instructions. Images were acquired using a microscope (Leica Microsystems, Mannheim, Germany).