Block it lentiviral rnai expression system
The BLOCK-iT™ Lentiviral RNAi Expression System is a laboratory tool designed for the expression of short hairpin RNA (shRNA) using a lentiviral delivery system. The system provides a platform for the stable knockdown of target genes in a variety of cell types.
Lab products found in correlation
22 protocols using block it lentiviral rnai expression system
Knockdown of BAF53 in NIH3T3 cells
Lentivirus-Mediated NeuroD1 Overexpression and Knockdown
Lentiviral Knockdown and Overexpression of lnc-PMIF
Establishing Stable Cell Lines via Lentiviral RNAi
Galectin-9 Silencing in MSCs
HNSCC Cell Lines and Knockdown
Lentiviral Linc-RAM shRNA Generation
shRNA-1 targeted to 249–269 of the Linc-RAM (GGTACTGATCTCTACTACTTC). shRNA-2 targeted to 372–394 of the Linc-RAM (GCAACCTGACTTTCTTTACTC).
Targeted Lentiviral Delivery of AK035396 shRNA
Lentiviral RNAi Knockdown of FAP in CAFs
Suppression of lncRNA AC005224.4 in SKOV3 cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!