Ribosafe rnase inhibitor

Manufactured by Meridian Bioscience

Sourced in United Kingdom

Ribosafe RNase inhibitor is a laboratory product designed to inhibit the activity of ribonucleases (RNases), enzymes that can degrade ribonucleic acid (RNA) molecules. It is a key component in maintaining the integrity of RNA samples during various molecular biology and biochemical procedures.

Automatically generated - may contain errors

Lab products found in correlation

Tissue total rna mini kit, by Geneaid (1 mentions) Rneasy plus mini kit, by Qiagen (1 mentions) Qubit rna hs assay kit, by Thermo Fisher Scientific (1 mentions) Tetro reverse transcriptase, by Meridian Bioscience (1 mentions) Rneasy extraction kit, by Qiagen (1 mentions) Touch real time pcr detection system, by Bio-Rad (1 mentions) Origin 7, by Malvern Panalytical (1 mentions) Trisure, by Meridian Bioscience (1 mentions) Tnt quick coupled transcription translation system, by Promega (1 mentions) Complete edta free protease inhibitor, by Roche (1 mentions) Nanodrop, by Thermo Fisher Scientific (1 mentions) Bioanalyzer, by Agilent Technologies (1 mentions) On column dnase 1 digestion set, by Merck Group (1 mentions) Gel loading dye, by New England Biolabs (1 mentions) Gel doc 2000 gel documentation system, by Bio-Rad (1 mentions) Primer express 3, by Thermo Fisher Scientific (1 mentions) Sensifast probe lo rox one step kit, by Meridian Bioscience (1 mentions) 50 bp dna ladder, by New England Biolabs (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

RNase inhibitor (8 citations) Ribosafe (2 citations)

10 protocols using ribosafe rnase inhibitor

Arbovirus Detection in Mosquito Pools by PCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Five mosquito species, consisting of one pool of Aedes albopictus, one pool of Armigeres subalbatus, one pool of Culex hutchinsoni, two pools of Culex tritaeniorhynchus, and five pools of Culex quinquefasciatus, were examined for arbovirus detection using polymerase chain reaction (PCR), following the procedure of Supriyono et al. [16 (link)] with PCR reagent modifications. RNA was extracted using tissue total RNA mini kit (Geneaid Biotech^®, Taiwan), according to the manufacturer’s recommendations. The total volume of PCR was 25 μL, consisting of 2.5 μL RNA sample, 12.5 μL of 2× MyTaq One-Step Mix, 1 μL of each forward and reverse primer (10 pmol/μL), 0.25 μL RT enzyme, 0.5 μL RiboSafe RNase inhibitor, and 7.5 μL diethyl pyrocarbonate-H₂O (Bioline, UK).
The primers used to amplify the sequences were MAMD and cFD2 with the non-structural protein target gene NS5 Flavivirus (252–260 bp long) and VIR2052F and VIR2052R with the non-structural protein target gene NS4 Alphavirus (144 bp long). Amplification was carried out using a SimpliAmp Thermal Cycler machine (Thermo Fisher Scientific, USA). The target gene, primer name, sequence, target size, and PCR conditions are presented in Table-1 [16 (link)]. The PCR product was electrophoresed on 1% agarose gel and visualized using an ultraviolet transilluminator.

Novianto D., Hadi U.K., Soviana S., Supriyono S., Rosmanah L, & Darusman H.S. (2022). Diversity of mosquito species and potential arbovirus transmission in long-tailed macaque (Macaca fascicularis) breeding facilities. Veterinary World, 15(8), 1961-1968.

+ Open protocol

+ Expand

Total RNA Extraction and Reverse Transcription

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA extraction, gDNA removal and reverse transcription were conducted as described previously [32 (link)]. Total RNA was extracted from the gonads using the RNeasy Plus Mini Kit (Qiagen, Chadstone, VIC, Australia). Tissues were lysed by repetitive aspirations through a sterile 19 and 25-gauge needle connected to a 3 mL sterile syringe, to produce a homogenized lysate. Column removal of gDNA and subsequent purification of lysate followed those as described in the manufacturer’s protocols. RNA integrity was examined for the 18 and 28 S rRNA bands using gel electrophoresis through a 1% agarose in Tris-acetate-EDTA (TAE) buffer. The concentration of total RNA was determined using Qubit RNA HS Assay Kit (Life Technologies, Mulgrave, VIC, Australia). A total of 60 ng uL⁻¹ of total RNA was used for reverse transcription using the Tetro Reverse Transcriptase and Ribosafe RNase inhibitor (Bioline, Eveleigh, NSW, Australia) as per the manufacturer’s protocols. The cDNA was stored at minus 20 °C and used without dilution in quantitative PCR.

Tran N.K., Kwan T.N., Purser J, & Patil J.G. (2022). Masculinization of Adult Gambusia holbrooki: A Case of Recapitulation of Protogyny in a Gonochorist?. Biology, 11(5), 694.

+ Open protocol

+ Expand

Quantitative RT-PCR for EV-A71 Mutant Strains

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from various EV-A71 mutant strains grown in RD cells using the RNeasy extraction kit (Qiagen, USA). Quantitative real-time PCR was performed using the Touch^TM Real-Time PCR Detection System (Bio-Rad, CFX96), with 4 μl of RNA template, 10 μl of 2x SensiFAST probe No-ROX One Step Mix, 0.8uL Forward and Reverse primer (10uM), 0.2 uL probe (10uM), 0.2 ul reverse transcriptase, and 0.4 uL RiboSafe RNase inhibitor (BioLine, California, USA) in 20 μl of the final reaction mixture. The reaction was performed for one cycle at 48 °C for 10min, 95 °C for 2min, followed by 40 cycles at 95 °C for 5s and 60 °C for 20s in a 96-well plate. Three independent experiments were conducted for each sample. Threshold cycle value (Cq) data was determined using default threshold settings, and the mean Cq was calculated from the duplicate PCRs. A standard graph was plotted based on a series of standard solutions.

Yee P.T., Tan K.O., Othman I, & Poh C.L. (2016). Identification of molecular determinants of cell culture growth characteristics of Enterovirus 71. Virology Journal, 13, 194.

+ Open protocol

+ Expand

Calorimetric Analysis of Protein-RNA Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

Concentrated proteins and ssRNA oligonucleotides stocks were diluted into the ITC buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1 mM DTT and 0.1 mM ZnCl₂). Samples were kept RNase free by adding all of the time RNase inhibitor (0.4 u/µL) (Ribosafe Rnase Inhibitor, Bioline). All experiments were carried out by titrating proteins (100 μM) into RNA (10 μM), on a MicroCal i200 ITC microcalorimeter (GE Healthcare) at 25 °C. For each titration, an initial injection of 0.5 μL (discarded data) and 20 injections of 2 μL of titrant were made at 120 s intervals. Experimental data were corrected by subtraction of dilution heats from control experiments (protein titration into buffer) and finally analyzed (Origin7.0, MicroCal Software, Northampton, MA). The data were fitted to a 1:1 (one-site) model.

De Franco S., Vandenameele J., Brans A., Verlaine O., Bendak K., Damblon C., Matagne A., Segal D.J., Galleni M., Mackay J.P, & Vandevenne M. (2019). Exploring the suitability of RanBP2-type Zinc Fingers for RNA-binding protein design. Scientific Reports, 9, 2484.

+ Open protocol

+ Expand

Polysomal RNA Isolation and Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Polysomal RNA isolation was performed as described previously (Slobodin et al., 2017 (link)). Briefly, Sucrose gradients for separation of polysomes were usually prepared by gentle sequential addition of 2.2mL of the different sucrose solutions (e.i., 47, 37, 27, 17 and 7% in Tris-HCl pH = 7.5 (f.c. 20mM), MgCl₂ (f.c. 10mM) and KCl (f.c. 100mM), supplemented with 2mM DTT, Ribosafe RNase inhibitor (Bioline, 1 μL/mL) and CHX (100 μg/mL) into a 12 mL tube (Beckman, 9/16 × 3 ½ in.) and left overnight at 4°C to achieve continuous gradient prior to the centrifugation. Cells were treated with CHX and harvest after washing with PBS with CHX and lysed. The lysates were centrifuged 1300xg for 10 min at 4°C and the supernatants were transferred into new tubes. From the cleared lysates, 500 μL were loaded on top of each gradient, mounted on SW41TI rotor and centrifuged at 36000rpm for 2 h at 4°C. Following the centrifugation, each gradient was split into 15 equal fractions of 760 μL. Fractions 9-13 were collected for RNA isolation using TRIsure (Bioline) according to the manufacturer’s instructions, polyA selected followed by RNA library preparation as previously describe (Takara; 634,839). The experiment was performed in two biological replicates.

Malka Y., Alkan F., Ju S., Körner P.R., Pataskar A., Shulman E., Loayza-Puch F., Champagne J., Wenzel C., Faller W.J., Elkon R., Lee C, & Agami R. (2022). Alternative cleavage and polyadenylation generates downstream uncapped RNA isoforms with translation potential. Molecular Cell, 82(20), 3840-3855.e8.

+ Open protocol

+ Expand

In Vitro Protein Co-Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Proteins were expressed in vitro using the TNT^® Quick Coupled Transcription/Translation System (Promega, Fitchburg, WI, USA). Groups of one, two or three proteins were co-expressed in the same reaction mixture. 25 μL (one protein), 50 μL (two proteins) or 75 μL (three proteins) of lysate master mix (MM) was used for each reaction. 25 μL of MM contained: 20 U of Ribosafe RNase inhibitor (Bioline, London, UK), 0.7 μL of 1 mM methionine and 1.5 μL cOmplete^® EDTA-free protease inhibitor (from 50× stock; Roche). 1.5 μg of each plasmid DNA was used per expressed protein. The reactions were incubated at 30 °C for 4 h. Prior to immunoprecipitation, lysis buffer was added to a final concentration of 50 mM Tris-HCl, 150 mM NaCl, 0.1% (v/v) Triton X-100, 1× cOmplete^® EDTA-free protease inhibitor (Roche), 1 mM DTT, pH 7.5.

Torrado M., Low J.K., Silva A.P., Schmidberger J.W., Sana M., Tabar M.S., Isilak M.E., Winning C.S., Kwong C., Bedward M.J., Sperlazza M.J., Williams DC J.r., Shepherd N.E, & Mackay J.P. (2017). Refinement of the subunit interaction network within the nucleosome remodelling and deacetylase (NuRD) complex. The FEBS journal, 284(24), 4216-4232.

+ Open protocol

+ Expand

RNA-seq Analysis of Triplicate Samples

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

All RNASeq experiments were performed in triplicate from three independent biological replicates. RNA was extracted and quantified as described above. RNA was treated with DNAse in solution using the On-Column DNase I Digestion Set (Sigma-Aldrich, St. Louis, MO, USA) and maintained with Ribosafe RNAse Inhibitor (Bioline, London, UK). Quality and quantity of RNA were assessed by Nanodrop (Thermo Scientific, Waltham, MA, USA), Qubit (Thermo Scientific, Waltham, MA, USA) and Bioanalyzer (Agilent, Santa Clara, CA, USA). Library preparation and sequencing were performed by Novogene. STAR aligner [22 (link)] was used for mapping sequence reads to the human genome (hg38 assembly), allowing up to three mismatches and retaining only reads that aligned with unique locations. Ensemble gene models [23 (link)] was used for quantifying gene expression from mapped reads using featureCounts [24 (link)], and genes that were lowly expressed (less than two samples with counts >10) were removed from subsequent analysis. Raw read counts were analyzed in RStudio using DESeq2, and differential expression was assessed [25 (link)]. Genes with adjusted p-values of <0.05 (Benjamani–Hochberg corrected) were assessed as differentially expressed.

Ruan T., Harney D., Koay Y.C., Loo L., Larance M, & Caron L. (2022). Anabolic Factors and Myokines Improve Differentiation of Human Embryonic Stem Cell Derived Skeletal Muscle Cells. Cells, 11(6), 963.

+ Open protocol

+ Expand

In Vitro RNA Transcription Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Universal T7 forward, and T7 reverse primers (1 μM each) were mixed with pET12b plasmids containing the corresponding genes^{19 (link),20 (link)} (0.01μM), Q5 reaction buffer (1X), dNTPs (0.2mM), Q5 High-Fidelity DNA Polymerase (20 U/mL) and dH₂O to complete 500μL reaction and allowed to PCR amplify according to the recommended temperatures and time for 15 cycles. Then DNA was solvent extracted (unbuffered phenol) and ethanol precipitated. The DNA pellet was dissolved in 100 μL of water and mixed with a transcription mix composed by: Tris/Triton (40mM pH=7.8), Spermidine (2.5mM), MgCl₂ (25mM), Dithiothreitol (10mM), UTP/GTP/CTP/ATP (5mM each), extra GTP (4mM), RiboSafe RNase Inhibitor (0.2U/μL Bioline Cat#: C755H60), T7 Polymerase (0.2μM) and inorganic pyrophosphatase (1μg/mL). Transcription was incubated overnight and further purified through urea denaturing gel electrophoresis; the gel was crushed and soaked in 0.3 M KCl overnight and supernatant was filtered, and ethanol precipitated. The pellet was dissolved in water. Then mRNAs were quantified by UV absorbance and were diluted to 30 μM and stored at −20 °C until used. The RNA sequences and the expected [M+H]+for each encoded peptide its sequence are shown in SI Table S2.

Shakya B., Joyner O.G, & Hartman M.C. (2022). Hyperaccurate ribosomes for improved genetic code reprogramming. ACS synthetic biology, 11(6), 2193-2201.

+ Open protocol

+ Expand

RT-PCR Assay for SARS-CoV-2 S Segment

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primers for RT-PCR (Forward: TCTGCTGGTGATGATGGATTAAA, Reverse: CATCTCACTTTTGTTTCTTCCTCTCA) were designed using Primer Express 3.0 (Applied Biosystems) based on the NZV S segment. RT-PCR assays were conducted in 25-µl reactions using a SensiFAST™ Probe Lo-ROX One-Step Kit (Cat# BIO-78005, BIOLINE) as follows: 5 µl of the purified RNA were added to 20 µl of reaction mix composed of 12.5 µl of 2 × SensiFAST™ Probe One-Step mix, 1.25 µl of molecular-grade H₂O, 2.75 µl of the forward and reverse primers (at final concentration of 0.55 µM), 0.5 µl of RiboSafe RNase Inhibitor (provided with the kit) and 0.25 µl of reverse transcriptase. The RT-PCR thermal cycle was as follows: 48 °C for 20 min, 95 °C for 2 min and 45 cycles of 94 °C for 15 sec and 60 °C for 35 sec. Fifteen microliters of each RT-PCR reaction was mixed with 3 µl of 6 × Gel Loading Dye (Cat# B7025S, New England BioLabs) and subjected to 2%-agarose/ethidium bromide gel electrophoresis. The agarose gel was then visualized under UV light using a Bio-Rad Gel Doc 2000 gel documentation system. A 50-bp DNA ladder (Cat# N3236L, New England Biolabs) was used for RT-PCR product size determination.

Shifman O., Cohen-Gihon I., Beth-Din A., Zvi A., Laskar O., Paran N., Epstein E., Stein D., Dorozko M., Wolf D., Yitzhaki S., Shapira S.C., Melamed S, & Israeli O. (2019). Identification and genetic characterization of a novel Orthobunyavirus species by a straightforward high-throughput sequencing-based approach. Scientific Reports, 9, 3398.

+ Open protocol

+ Expand

Polysomal RNA Isolation and Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Polysomal RNA isolation was performed as described previously.²³¹ (link) Briefly, Sucrose gradients for separation of polysomes were usually prepared by gentle sequential addition of 2.2 ml of the different sucrose solutions (e.i., 47, 37, 27, 17 and 7% in Tris-HCl pH 7.5 (20 mM), MgCl₂ (10 mM) and KCl (100 mM), supplemented with 2 mM DTT (10197777001, Sigma), Ribosafe RNase inhibitor (1 μl/ml, BIO-65027, Bioline) and CHX (100 μg/ml, 239763, Sigma) into a 12 mL tube (Beckman, 9/16 × 3 1/2 in.) and left overnight at 4°C to achieve continuous gradient prior to the centrifugation. Cells were treated with 100 μg/mL CHX and harvest after washing with PBS with CHX and lysed. The lysates were centrifuged 1300 xg for 10 min at 4°C and the supernatants were transferred into new tubes. From the cleared lysates, 500 μL was loaded on top of each gradient, mounted on SW41TI rotor and centrifuged at 36000 rpm for 2 hr at 4°C. Following the centrifugation, each gradient was split into 15 equal fractions of 760 μl. Fractions 9-13 were collected for RNA isolation using TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions, polyA selected and followed by RNA library preparation as described above for mRNA-Seq.

Lin C.P., Levy P.L., Alflen A., Apriamashvili G., Ligtenberg M.A., Vredevoogd D.W., Bleijerveld O.B., Alkan F., Malka Y., Hoekman L., Markovits E., George A., Traets J.J., Krijgsman O., van Vliet A., Poźniak J., Pulido-Vicuña C.A., de Bruijn B., van Hal-van Veen S.E., Boshuizen J., van der Helm P.W., Díaz-Gómez J., Warda H., Behrens L.M., Mardesic P., Dehni B., Visser N.L., Marine J.C., Markel G., Faller W.J., Altelaar M., Agami R., Besser M.J, & Peeper D.S. (2024). Multimodal stimulation screens reveal unique and shared genes limiting T cell fitness. Cancer Cell, 42(4), 623-645.e10.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!