Avian myeloblastosis virus reverse transcriptase

Gene expression was assayed by Taqman and standard PCR. Briefly, RNA was prepared from B cells using Ultraspec (BiotecX) and chloroform extraction. Following isolation RNA was treated with DNaseI (Ambion) to remove contaminating DNA. cDNA was prepared using avian myeloblastosis virus reverse transcriptase (Bio-Rad). For TdT expression analysis following culture RNA was prepared from 10,000-100,000 cells (Cells-to-Ct kit, Ambion). Gene expression was measured by real-time PCR using Taqman chemistry. Primer and probe sets were obtained from Applied Biosystems for TdT (Mm00493500_m1) and β-Actin, which was used for normalization. Gene expression was also measured by standard PCR. The following primer sets were adapted from (29 (link)) and used for standard PCR: Actin (5’ CCTAAGGCCAACCGTGAAAAG; 3’ TCTTCATGGTGCTAGGAGCCA) and TdT (5’ GAAGATGGGAACAACTCGAAGAG; 3’ CAGGTGCTGGAACATTCTGGGAG). Products of amplification were run on a 2% agarose gel.