Total RNA was isolated from A549 cells using the TRIzol reagent (Thermo Fisher Scientific). cDNAs were synthesized using reverse transcription with Superscript II RNase H-RT according to the manufacturer’s instructions (Thermo Fisher Scientific). The full length DCXR gene was amplified by PCR using Pfu Easy A polymerase (Agilent, Santa Clara, CA) with the primer pairs hDCXR-F ccgcgcggcagccatatggagctgttcctc and hDCXR-R cgaattcggatccttatcagcaggccca. Forward primers (hDCXR-F) contain an NdeI restriction site and 15 nucleotides at the 5′-end of DCXR, and reverse primers (hDCXR-R) contain a BamHI restriction site and 15 nucleotides at the 3′-end of DCXR, according to the published human DCXR sequence (accession number: NM_016286.3, PubMed). The PCR products were purified using a PCR purification kit (Qiagen, Valencia, CA), cloned into the TA vector pGEM-T (Promega), and transformed into Escherichia coli DH10B cells. The pGEMT-hDCXR was isolated using a plasmid miniprep kit (Qiagen), digested with NdeI and BamHI restriction enzymes, and then subcloned into the NdeI and BamHI sites of pET28a, which carries a hexa-histidine tag coding sequence (Novagen, Madison, WI). Positive clones were selected and verified by sequence analysis (DNA Core facility, Rutgers University-Robert Wood Johnson Medical School, Piscataway, NJ).
Superscript 2 rnase h rt
Manufactured by Thermo Fisher Scientific
Sourced in United States
Superscript II RNase H-RT is a reverse transcriptase enzyme used in the synthesis of first-strand cDNA from RNA templates. It possesses both reverse transcriptase and RNase H activities.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (5 mentions)
Random hexamer, by Thermo Fisher Scientific (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Taqman real time pcr system, by Thermo Fisher Scientific (2 mentions)
Pfu easy a polymerase, by Agilent Technologies (1 mentions)
Plasmid miniprep kit, by Qiagen (1 mentions)
Pcr purification kit, by Qiagen (1 mentions)
Taqman universal pcr master mix core reagent kit, by Thermo Fisher Scientific (1 mentions)
Rnasin, by Thermo Fisher Scientific (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
Novex wedgewell 4 20 tris glycine gel, by Thermo Fisher Scientific (1 mentions)
Pyromark gold 96 reagents kit, by Qiagen (1 mentions)
Rnase inhibitor, by Avantor (1 mentions)
Rnalater, by Qiagen (1 mentions)
Pyromark pcr kit, by Qiagen (1 mentions)
Nucleospin rna 2 kit, by Macherey-Nagel (1 mentions)
Wizard dna clean up system, by Promega (1 mentions)
Allprep dna rna mini kit, by Qiagen (1 mentions)
Dna polymerase, by Thermo Fisher Scientific (1 mentions)
8 protocols using superscript 2 rnase h rt
1
Cloning and Expression of Human DCXR
2
Quantifying Gene Expression in Pancreatic Islets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the isolated islets using an RNeasy Mini Kit (Qiagen, Tokyo, Japan). After quantifying the RNA using spectrophotometry, 2.5 µg of RNA was heated at 85 °C for 3 min and then reverse-transcribed in a 25-µl reaction mixture containing 200 units of Superscript II RNase H-RT (Thermo Fisher Scientific), 50 ng random hexamers (Thermo Fisher Scientific), 160 µmol/l dNTP and 10 nmol/l dithiothreitol. The reaction mixture was incubated for 10 min at 25 °C, 60 min at 42 °C and 10 min at 95 °C.
The mRNAs were quantitated using the TaqMan real-time PCR system according to the manufacturer’s instructions (Applied Biosystems, Foster City, CA, USA). PCR was performed for 40 cycles, and the reactions were incubated for 2 min at 50 °C and 10 min at 95 °C for the initial steps. In each cycle, denaturation was performed for 15 s at 95 °C, and annealing/extension was performed for 1 min at 60 °C. PCR was performed in 20 µl of solution using cDNAs synthesized from 1.11 ng of total RNA. The amount of mRNA was normalized by dividing the amount of the mRNA of interest by that of Gapdh mRNA. Primers specific for mouse Ins1, Ins2, Pdx1, NeuroD, MafA, and Gapdh were purchased as Assays-on-Demand Gene Expression Products (Applied Biosystems).
The mRNAs were quantitated using the TaqMan real-time PCR system according to the manufacturer’s instructions (Applied Biosystems, Foster City, CA, USA). PCR was performed for 40 cycles, and the reactions were incubated for 2 min at 50 °C and 10 min at 95 °C for the initial steps. In each cycle, denaturation was performed for 15 s at 95 °C, and annealing/extension was performed for 1 min at 60 °C. PCR was performed in 20 µl of solution using cDNAs synthesized from 1.11 ng of total RNA. The amount of mRNA was normalized by dividing the amount of the mRNA of interest by that of Gapdh mRNA. Primers specific for mouse Ins1, Ins2, Pdx1, NeuroD, MafA, and Gapdh were purchased as Assays-on-Demand Gene Expression Products (Applied Biosystems).
3
Quantitative PCR Analysis of Islet Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from isolated islets using an RNeasy Mini Kit (Qiagen, Tokyo, Japan). After quantifying the RNA using spectrophotometry, 2.5 µg of RNA was heated at 85 °C for 3 min and then reverse-transcribed in a 25-µL reaction mixture containing 200 units of Superscript II RNase H-RT (Thermo Fisher Scientific), 50 ng random hexamers (Thermo Fisher Scientific), 160 µmol/l dNTP and 10 nmol/l dithiothreitol. The reaction mixture was incubated for 10 min at 25 °C, 60 min at 42 °C and 10 min at 95 °C26 (link).
Quantitative PCR amplification of cDNA from mouse islets was performed using a TaqMan universal PCR master mix core reagent kit according to the manufacturer’s instructions (Applied Biosystems, Foster City, CA, USA). PCR was performed for 40 cycles, and the reactions were incubated for 2 min at 50 °C and 10 min at 95 °C for the initial steps. In each cycle, denaturation was performed for 15 s at 95 °C, and annealing/extension was performed for 1 min at 60 °C. PCR was performed in 20 µL of solution using cDNAs synthesized from 1.11 ng of total RNA. The amount of mRNA was normalized by dividing the amount of the mRNA of interest by that of Gapdh mRNA. Primers specific for mouse Ins1, Ins2, Pdx1, Nkx2.2, MafA and Gapdh were purchased as Assays-on-Demand Gene Expression Products (Applied Biosystems)26 (link).
Quantitative PCR amplification of cDNA from mouse islets was performed using a TaqMan universal PCR master mix core reagent kit according to the manufacturer’s instructions (Applied Biosystems, Foster City, CA, USA). PCR was performed for 40 cycles, and the reactions were incubated for 2 min at 50 °C and 10 min at 95 °C for the initial steps. In each cycle, denaturation was performed for 15 s at 95 °C, and annealing/extension was performed for 1 min at 60 °C. PCR was performed in 20 µL of solution using cDNAs synthesized from 1.11 ng of total RNA. The amount of mRNA was normalized by dividing the amount of the mRNA of interest by that of Gapdh mRNA. Primers specific for mouse Ins1, Ins2, Pdx1, Nkx2.2, MafA and Gapdh were purchased as Assays-on-Demand Gene Expression Products (Applied Biosystems)26 (link).
4
Differential Display of Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Differential display was performed according to the method of Liang and Parde [25] (link) with minor modifications. Total RNA was treated with RNase free DNase-I (0.1 U per mg RNA for 30 min) to remove the contaminating genomic DNA. In brief, first strand cDNAs was synthesized using 2 μg of Total RNA and 10 mM oligo dT primer. Initial incubation was at 70˚C for 5 min followed by quick chilling on ice. To this, 40 units of Superscript™ II RNase H RT (Thermo Scientific), 20 units RNasin (Thermo Scientific), 0. for annealing and 72˚C/60s for extension and 72˚C for 15 min for final extension. Each reaction was run in triplicate, and products obtained were subjected to denaturing 6% urea gel electrophoresis at a voltage of 0.45 V/cm 2 for 12 h at room temperature. DNA was visualized by staining with ethidium bromide and documented using Alpha Imager gel doc. Differential bands were excised and cloned into pGEM-T-easy vector (Promega) according to manufacturer's instructions. Plasmid expressing the band of interest was sequenced on an automated sequencer (ABI PRISM 3700) using Bio Rad Taq cycle sequencing kit (Amersham Pharmacia Biotech,). Sequence analysis was performed using BLASTn (http://www.ncbi.nlm.nih.gov/blast). All of these ESTs were submitted to the dbEST database at NCBI (http://www.ebi.ac.uk).
5
Adiponectin Receptor Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA stabilization solution (RNAlater), Pyromark PCR kit, and Pyromark Gold 96 Reagents kit were purchased from Qiagen (Hilden, Germany). The Nucleospin RNA II kit was obtained from Macherey-Nagel (Düren, Germany). Superscript II RNase H-RT, primers, and NovexWedgeWell™ 4–20% Tris-Glycine gel were from Invitrogen (Carlsbad, USA), and RNase inhibitor was obtained from AMRESCO (Solon, USA). The Protein Assay Dye Reagent Concentrate Bradford was purchased from BioRad (München, Germany). Polyclonal goat anti-ADIPOR1 (sc-46749), anti-ADIPOR2 (sc-46756), and mouse anti-leptin (sc-48408) antibodies were from Santa Cruz Biotechnology (Dallas, USA). The rabbit polyclonal anti–LEPR (ab104403) antibody was obtained from Abcam (Cambridge, UK). The mouse monoclonal anti-cytokeratin pan-antibody (KL1) was sourced from Dako Cytomation (Glostrup, Denmark). DyNAmo ColorFlash SYBR Green and the SuperSignal West Pico Chemiluminescent Substrate detection kit were obtained from Fisher Scientific (Waltham, USA). The SPlink Broad kit with DAB chromogen was purchased from GBI Labs Golden Bridge International (Bothell, USA). The Wizard DNA Clean-Up system was bought from Promega (Madison, USA).
6
Reverse Transcription and PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using the AllPrep DNA/RNA Mini Kit or the RNeasy Mini Kit (#80204; QIAGEN). RNA (2.5 μg) was heated at 85°C for 3 min and then reverse-transcribed into cDNA in a 25-μl reaction volume containing 200 units of Superscript II RNase H-RT (#18080–044; Invitrogen Co.), 50 ng of random hexamers, 160 μmol/l of dNTPs, and 10 nmol/l of dithiothreitol. The reaction conditions were as follows: 10 min at 25°C, 60 min at 42°C, followed by 10 min at 95°C. PCR was performed using the same conditions described in the PCR section, except that cDNA (~20 ng) was used as the template instead of genomic DNA.
7
Quantitative Analysis of mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells (1.0 × 105 cells/mL) were pre-cultured overnight. The pre-cultured cells with or without pterixin (2 and 50 μM) were incubated for 24 h, then the total RNA was extracted from cells with or without test compounds by a RNeasy Mini Kit (QIAGEN, Venlo, Netherlands) using commercially available procedures. Briefly, the RNA extract (2.5 μg) was heated for three minutes at 85 °C, then it was reverse-transcribed into cDNA using Superscript II RNase H-RT (Invitrogen, Waltham, MA, USA). Polymerization of 20 ng cDNA was manually carried out using DNA polymerase (Invitrogen) under amplification cycles for denaturation at 94 °C for 1 min, annealing at 57–62 °C for 1 min, and extension at 72 °C for 1 min with a final extension step at 72 °C for 10 min (Perkin-Elmer 9700 Thermocycler, Perkin Elmer, Inc., Waltham, MA, USA). Quantification of the mRNA levels was carried using a TaqMan real-time PCR system, according to the manufacturer’s instructions (Applied Biosystems, Inc., Waltham, MA, USA). The PCR was performed for 40 cycles, including the initial step at 50 °C for 2 min and at 95 °C for 10 min for denaturation, 15 s at 95 °C, annealing/extension, and 1 min at 60 °C. Each mRNA expression was normalized by the GAPDH mRNA expression level.
8
Quantifying Inflammatory Cytokines in LI-LPMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total LI-LPMC mRNA was purified from LI-LPMCs using the RNeasy Mini Kit (QIAGEN, Venlo, Netherlands). Reverse transcription was carried out with 1 μg of RNA using 200 U of Superscript II RNase H- RT (Invitrogen™, Carlsbad, CA, USA). Complementary DNA (cDNA) was amplified by polymerase chain reaction. In this analysis, chronic inflammatory responses in LI-LPMC were evaluated by the gene expression of IFN-γ, IL-6, and TNF-α. The expression of other inflammatory cytokines such as IL-1β, IL-10, IL-17α, IL-18, IL-22, and IL-23 was also measured, but did not change (S1 Table ). Urocortins (UCNs) belong to the corticotropin releasing hormone (CRH) family, and are known to bind CRH receptors (CRHRs) to activate CRH-mediated pathways in peripheral tissues [21 (link)]. An increase in CRH is a known indicator of activation of the central nervous system (CNS) [22 (link)], and we considered UCNs to be an indicator of this in peripheral tissue. Expression of all genes in each sample was quantified relative to glyceraldehyde 3-phosphate dehydrogenase (GAPDH).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!