To determine the a mount of mRNA expression, cells were exposed to hyperosmotic media (500 mOsm/kg DMEM/F-12, serum-free) for 30 minutes, followed by diquafosol for 4 hours, as previously described [15 (link)]. Total RNA was isolated from the cells with Trizol reagent (Life Technologies, Rockville, MD, USA), according to the manufacturer's instructions, and reverse-transcribed into complementary DNA with M-MLV reverse transcriptase (Promega, Madison, WI, USA). Real-time polymerase chain reaction (PCR) was performed using SYBR Premix Ex Taq (Perfect Real Time) Premix (Takara Bio, Otsu, Japan) and Takara Thermal Cycler Dice (TP850), according to the manufacturer's protocol (Takara Bio, Shiga, Japan). Relative quantification of mRNA expression was performed using TP850 software. Table 1 shows the gene-specific primers used in this study (Macrogen, Seoul, Korea). PCR products were electrophoresed on 1% agarose gels and visualized by GreenLight (BioAssay Co., Daejeon, Korea). PCR conditions are indicated in Table 1 . All experiments were performed in triplicate.
Takara thermal cycler dice
Manufactured by Takara Bio
Sourced in Japan
The Takara Thermal Cycler Dice is a laboratory instrument used for thermal cycling, a process essential for techniques such as Polymerase Chain Reaction (PCR). The device precisely controls the temperature of samples to facilitate the amplification of specific DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (2 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (2 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
Mirneasy serum plasma spike in control, by Qiagen (1 mentions)
Miscript 2 rt kit, by Qiagen (1 mentions)
Mirneasy serum plasma kit, by Qiagen (1 mentions)
Viral gene spin viral dna rna extraction kit, by iNtRON Biotechnology (1 mentions)
Takara pcr thermal cycler mp, by Takara Bio (1 mentions)
Thermal cycler dice real time system version 4, by Takara Bio (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Purelink dnase set, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq 2 tli rnaseh plus, by Takara Bio (1 mentions)
Gelred nucleic acid gel stain, by Biotium (1 mentions)
Gotaq green master mix, by Promega (1 mentions)
8 protocols using takara thermal cycler dice
1
Quantifying mRNA Expression Under Osmotic Stress
2
Plasma RNA Extraction and RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Blood samples were collected in disodium ethylenediaminetetraacetate tubes and centrifuged at 1500×g at 4 °C for 20 min, after which plasma was separated and frozen at − 80 °C. Total plasma RNA was extracted from 200 μL of plasma using an miRNeasy Serum/Plasma Kit (QIAGEN). In the RT-qPCR array, 6.3 × 108 copies of synthetic Caenorhabditis elegans mir-39 (miRNeasy Serum/Plasma Spike-In Control, QIAGEN) were added to each plasma sample in order to normalize and monitor extraction efficiency. Total RNA was reverse-transcribed to complementary DNA (cDNA) using a miScript II RT Kit (QIAGEN) and thermal cycler system (TaKaRa Thermal Cycler Dice, Takara). All protocols were performed in accordance with the manufacturers’ standard instructions.
3
Viral RNA Extraction and Multiplex PCR Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNAs were extracted by using the Viral Gene-Spin™ Viral DNA/RNA Extraction Kit (iNtRON Biotechnology, Sungnam, South Korea), according to the manufacturer's instructions. Viral RNAs were reverse-transcribed into first-strand cDNAs with a random hexamer primer by using the Power cDNA Synthesis Kit (iNtRON). Singleplex and multiplex PCRs were performed in the same condition. Both PCR amplifications were performed in a total volume of 50 μL containing 50 mM KCl, 10 mM Tris–HCl (pH 8.3; 25 °C), 1.5 mM MgCl, 200 μM of each dNTP, 10 μM of each primer, 5 units of Taq polymerase (iNtRON), and 2 μL of template. PCR was performed by using the TaKaRa Thermal Cycler Dice (TaKaRa Bio, Otsu, Japan) under the following conditions: 94 °C for 3 min, followed by 35 cycles of 94 °C for 30 s, 50 °C for 30 s, and 72 °C for 40 s, and a final extension cycle at 72 °C for 5 min. The PCR products were separated by agarose gel electrophoresis for 40 min at 100 V, followed by staining with ethidium bromide for visualization under ultraviolet light. The expected sizes of the amplicon were 380 bp (common), 209 bp (CCoV-specific), and 452 and 623 bp (TGEV-specific).
4
Real-Time PCR Analysis of iNOS mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression levels of iNOS mRNA in ACs and total BAL cells were determined by quantitative real‐time PCR (qRT‐PCR) as described previously.12 First‐strand cDNA was synthesized by PrimeScript RT Reagent Kit (Takara Bio, Shiga, Japan) with both oligo(dT) primer and random hexamers. Reverse transcription was performed with a TaKaRa PCR Thermal Cycler MP (TP3000, Takara Bio). The following sequences were used for iNOS and GAPDH. iNOS: forward primer, 5′‐GCACGGCAACACATTGAA‐3′; reverse primer, 5′‐TGAGGTTCTGAAGGCCTAAATC‐3′; GAPDH: forward primer, 5′‐GCACCGTCAAGGCTGAGAAC‐3′; reverse primer, 5′‐TGGTGAAGACGCCAGTGGA‐3′.
Diluted first‐strand cDNA product (4 μL) was used for amplification in a 25‐μL reaction solution containing 12.5 μL SYBR Premix Ex Taq II (Takara Bio) and 1 μL of each primer. DNA was amplified for 40 cycles of denaturation at 95°C for 5 seconds and annealed at 60°C for 30 seconds with the Takara Thermal Cycler Dice (TP900; Takara Bio). The data generated from each PCR reaction were analysed using Thermal Cycler Dice Real Time System version 4.2 (Takara Bio). The specificity of the reactions was determined by melting curve analysis. The relative expression of each gene of interest and GAPDH were calculated by the ΔΔCt method.
Diluted first‐strand cDNA product (4 μL) was used for amplification in a 25‐μL reaction solution containing 12.5 μL SYBR Premix Ex Taq II (Takara Bio) and 1 μL of each primer. DNA was amplified for 40 cycles of denaturation at 95°C for 5 seconds and annealed at 60°C for 30 seconds with the Takara Thermal Cycler Dice (TP900; Takara Bio). The data generated from each PCR reaction were analysed using Thermal Cycler Dice Real Time System version 4.2 (Takara Bio). The specificity of the reactions was determined by melting curve analysis. The relative expression of each gene of interest and GAPDH were calculated by the ΔΔCt method.
5
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from each sample using Trizol. RNA (1 μg) was employed in qRT-PCR using qPCR Master Mix. PCR amplification was performed using the incorporation of SYBR green. The oligonucleotide primers were listed as follows:
iNOS: 5′-GGCAGCCTGTGAGACCTTTG-3′ (forward) and 5′-GCATTGGAAGTGAAGCGTTTC-3′ (reverse);
TNF-α: 5′-TTCTGTCTACTGAACTTCGGGGTGATCGGTCC-3′ (forward) and 5′-GTATGAGATAGCAAATCGGCTGACGGTGTGGG-3′ (reverse);
IL-6: 5′-TCCAGTTGCCTTCTTGGGAC-3′ (forward) and 5′-GTGTAATTAAGCCTCCGACTTG-3′ (reverse);
COX-2: 5′-TGAGTACCGCAAACGCTTCTC-3′ (forward) and 5′-TGGACGAGGTTTTTCCACCAG-3′ (reverse);
IL-1β: 5′-GAAAGACGGCACACCCACCCT-3′ (forward) and 5′-GCTCTGCTTGTGAGGTGCTGATGTA-3′ (reverse); and
GAPDH: 5′-CATGACCACAGTCCATGCCATCAC-3′ (forward) and 5′-TGAGGTCCACCACCCTGTTGCTGT-3′ (reverse).
Steady-state mRNA levels of iNOS, TNF-α, IL-6, COX-2, IL-1β, and GAPDH were determined using the Takara Thermal Cycler Dice (Takara Bio Inc., Shiga, Japan).
iNOS: 5′-GGCAGCCTGTGAGACCTTTG-3′ (forward) and 5′-GCATTGGAAGTGAAGCGTTTC-3′ (reverse);
TNF-α: 5′-TTCTGTCTACTGAACTTCGGGGTGATCGGTCC-3′ (forward) and 5′-GTATGAGATAGCAAATCGGCTGACGGTGTGGG-3′ (reverse);
IL-6: 5′-TCCAGTTGCCTTCTTGGGAC-3′ (forward) and 5′-GTGTAATTAAGCCTCCGACTTG-3′ (reverse);
COX-2: 5′-TGAGTACCGCAAACGCTTCTC-3′ (forward) and 5′-TGGACGAGGTTTTTCCACCAG-3′ (reverse);
IL-1β: 5′-GAAAGACGGCACACCCACCCT-3′ (forward) and 5′-GCTCTGCTTGTGAGGTGCTGATGTA-3′ (reverse); and
GAPDH: 5′-CATGACCACAGTCCATGCCATCAC-3′ (forward) and 5′-TGAGGTCCACCACCCTGTTGCTGT-3′ (reverse).
Steady-state mRNA levels of iNOS, TNF-α, IL-6, COX-2, IL-1β, and GAPDH were determined using the Takara Thermal Cycler Dice (Takara Bio Inc., Shiga, Japan).
6
Chrysanthemum Petal Total RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from petals of chrysanthemums by using TRIzol Reagent (Thermo Fisher Scientific) and the PureLink RNA Mini Kit (Thermo Fisher Scientific) and then treated with the PureLink DNase Set (Thermo Fisher Scientific), in accordance with the manufacturer’s instructions. First-strand complementary DNAs (cDNAs) were synthesized by the SuperScript III First-Strand Synthesis System (Thermo Fisher Scientific) from 1 μg of total RNA in 20 μl of reaction mixture. The resulting cDNA (50 ng) in 20 μl of qRT-PCR mixture with SYBR Premix Ex Taq II (Tli RNase H Plus) (Takara Bio) was subjected to qRT-PCR on Takara Thermal Cycler Dice (TP800), in accordance with the manufacturer’s protocol (Takara Bio). The primers BGT49F (5′-caccttccacctctcttgaacc-3′) and BGT133R (5′-aagtgtgtgtgccgatgaatg-3′) were used for CtA3′5′GT expression analyses. Expression of CamF3′5′H mRNA and actin mRNA as a control was analyzed as previously described (6 (link)). Levels of transgene mRNAs were normalized to actin mRNA and were presented relative to transformant 1916-18, which contained 65% of delphinidin-based anthocyanins and the same total anthocyanin content as wild type.
7
Identification of Bacterial Isolates via 16S rDNA PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Colony PCR of purified bacterial isolate was performed using universal 16S rDNA primers, 27f (5´-AGAGTTTGATCCTGGCTCAG-3´) and 1492r (5´-GGTTACCTTGTTACGACTT-3´). The PCR reaction (50 μL) consisted of 25 μL GoTaq Green Master Mix (Promega), 1 μL 1492r primer (10 pM), and 1 μL 27f primer (10 pM), and a tiny amount of single bacterial colony. The PCR reaction was performed for 30 cycles using Takara Thermal Cycler Dice (Takara Co. Inc.) with the following conditions: 94C for 5 min of predenaturation, 94C for 1 min of denaturation, 55C for 1 min of annealing, 72C for 1 min of elongation and 72C for 5 min of final extension. Visualization of PCR products was performed in gel electrophoresis agarose 1% with GelRed Nucleic Acid Gel Stain (Biotium). The 1 Kb DNA ladder (Geneaid) was used to determine the size of PCR amplicon in the agarose gel. The sequencing of the 16S rRNA (ribosomal ribonucleic acid) gene was conducted by First BASE Laboratories.
8
Quantification of MMP-2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted from treated cells using TRIzol reagent (gibco). Total RNA (0.5 µg) was used for cDNA synthesis with the maxime RT-PCR Premix kit (Intron, Seongnam, Republic of Korea). PCR was carried out in Takara thermal cycler dice (Takara Bio, Inc., Shiga, Japan) to amplify MMP-2 and gAPDH mRNA. Primer sequences used to amplify the desired cDNA were as follows: MMP-2 (forward primer: gCC TgA gCT CCC ggA AAA GAT TG, reverse primer: CAG CAG CCT AGC CAG TCG gAT TT), gAPDH (forward primer: CgT CTT CAC CAC CAT GGA GA, reverse primer: CGG CCA TCA CGC CAC AgT TT). PCR products electrophoresed on 2% agarose gels were visualized by ethidium bromide staining.
Statistical analysis. Data are presented as means ± standard error of the mean (SEM) [means ± standard deviation (SD) in the results] from at least three independent experiments and evaluated by analysis of variance (ANOVA) followed by Tukey's post-hoc test. Values of p<0.05 were considered statistically significant.
Statistical analysis. Data are presented as means ± standard error of the mean (SEM) [means ± standard deviation (SD) in the results] from at least three independent experiments and evaluated by analysis of variance (ANOVA) followed by Tukey's post-hoc test. Values of p<0.05 were considered statistically significant.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!