sureselect protocol, by Agilent Technologies - Product details

1

Targeted Sequencing of Conifer DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

All samples were freeze-dried prior to DNA extraction except for megagametophytes, which were excised from pine seeds and ground fresh. Samples were ground using a MiniG^® tissue homogenizer (SPEX Sample Prep, Metuchen, NJ) and 5/32-inch stainless steel balls. DNA was extracted from all samples using the NucleoSpin^®96 Plant II kit (Macherey-Nagel).
DNA was submitted to RAPiD Genomics (Gainesville, FL, USA), for library construction, target enrichment, and sequencing, following protocols previously described for loblolly pine (Neves et al. 2013 (link)). Briefly, an average of 500 ng of DNA was sheared to an average fragment length of 300–500 bp, end-repaired and ligated to Illumina TruSeq compatible adapters containing unique indexes to identify the samples upon sequencing. Properly ligated libraries were enriched by PCR and hybridized to the probes following Agilent’s SureSelect protocol. A total of 334 target-enriched libraries were then sequenced on an Illumina HiSeq 3000 machine using a paired-end 150 bp cycle.

Ence D., Smith K.E., Fan S., Gomide Neves L., Paul R., Wegrzyn J., Peter G.F., Kirst M., Brawner J., Nelson C.D, & Davis J.M. (2021). NLR diversity and candidate fusiform rust resistance genes in loblolly pine. G3: Genes|Genomes|Genetics, 12(2), jkab421.

+ Open protocol

+ Expand

2

Customized Adapters for Illumina Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Custom adapters were designed to match Illumina PE adapters with an additional 4 nucleotide ‘barcode’ sequence located internal to the first and second read sequencing (Supplementary Fig. 2). Barcode sequences were designed to require errors in at least 2 locations to be misidentified, allowing for error correction with the use of paired reads tolerant to up to 3 errors.
Sample workflow is detailed in Supplementary Figure 3A. Libraries were constructed per the SureSelect protocol (Agilent) with custom adapters replacing the Illumina PE adapters. Samples were quantified by bioanalyzer prior to capture, and pooled in equimolar quantity with 10 libraries to a pool in the case of cell lines and 8 libraries to a pool in the case of melanoma tumor samples to a final quantity of 500ng. Four samples for which a matched normal was available were prepared with the SureSelect XT library preparation kit (Agilent) by manufacturer protocols. Capture and post capture amplification for all samples proceeded by SureSelect protocol. Samples were sequenced on the GAII or HiSeq machine in a variety of formats (see Supplementary Table 3).

Jeck W.R., Parker J., Carson C.C., Shields J.M., Sambade M.J., Peters E.C., Burd C.E., Thomas N.E., Chiang D.Y., Liu W., Eberhard D.A., Ollila D., Grilley-Olson J., Moschos S., Hayes D.N, & Sharpless N.E. (2014). Targeted Next Generation Sequencing Identifies Clinically Actionable Mutations in Patients with Melanoma. Pigment cell & melanoma research, 27(4), 653-663.

+ Open protocol

+ Expand

3

Capture Hi-C Library Preparation and Target Enrichment

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Capture Hi-C libraries were prepared according to the protocol described in (Jäger et al., 2015 (link)). The protocol consists of two parts: Hi-C library preparation and target enrichment (Figure 1A). A SureSelect Custom Target Enrichment Library covering a 3 Mb region in the 8p23.1 (hg19 coordinates: chr8:8,190,000–11,838,000) was designed using eArray software (Agilent). Hi-C library preparation, comprising chromatin fixation, HindIII digestion, biotin labelling, ligation, and crosslink reversal was performed as described in (Rao et al., 2014 (link)) with minor modifications described in (Jäger et al., 2015 (link)). Target enrichment was performed according to the SureSelect protocol (Agilent) with minor modifications described in (Jäger et al., 2015 (link)). We have prepared 10 capture Hi-C libraries from 5 independent batches of NA07000 cells and 4 capture Hi-C libraries from 2 independent batches of NA07056 cells. The libraries were sequenced on Illumina HiSeq 2,500 system, producing 461 million and 206 million paired-end 2 × 125 bp reads for NA07000 and NA07056, respectively.

Saint Just Ribeiro M., Tripathi P., Namjou B., Harley J.B, & Chepelev I. (2022). Haplotype-specific chromatin looping reveals genetic interactions of regulatory regions modulating gene expression in 8p23.1. Frontiers in Genetics, 13, 1008582.

+ Open protocol

+ Expand

4

Exome Sequencing from Whole Blood

Check if the same lab product or an alternative is used in the 5 most similar protocols

Patient genomic DNA, isolated from whole blood, was delivered for exome sequencing. In brief, the sample was prepared and enrichment was carried out according to Agilent's Sure Select Protocol Version 1.2. Concentration of the library was determined using Agilent's QPCR NGS Library Quantification Kit and adjusted to final concentration of 10 nM. Sequencing was performed on the Illumina HiSeq2000 platform using TruSeq v3 chemistry.

Friedrich C., Rinné S., Zumhagen S., Kiper A.K., Silbernagel N., Netter M.F., Stallmeyer B., Schulze-Bahr E, & Decher N. (2014). Gain-of-function mutation in TASK-4 channels and severe cardiac conduction disorder. EMBO Molecular Medicine, 6(7), 937-951.

+ Open protocol

+ Expand

5

Hi-C Library Enrichment and Amplification

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Target enrichment was performed based on the SureSelect protocol (Agilent, Santa Clara, CA, USA), but incorporating the following modifications: (i) Biotinylated Hi-C di-tags bound to streptavidin beads were amplified pre-hybridisation directly from beads using 24 parallel 25 µl PCR reactions with five to eight cycles using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, USA) and pre-hybridisation PCR primers: ACACTCTTTCCCTACACGACGCTCTTCCGATC*T and CTCGGCATTCCTGCTGAACCGCTCTTCCGATC*T. PCR products were pooled and purified using Agencourt Ampure XP beads (Beckman Coulter, Brea, CA, USA) to yield ~750–1300 ng total DNA. 750 ng of library DNA was dried using a speedvac concentrator then resuspended in 3.4 µl of water. (ii) Enriched fragments were amplified post-hybridisation again directly from the streptavidin beads, using 18 parallel 25 µl reactions of five to eight cycles of PCR. PCR products were again pooled and purified using Agencourt Ampure XP beads (Beckman Coulter, Brea, CA, USA). Post-hybridisation PCR primers to the paired-end adaptors were as described in Belton and colleagues^{52 (link)}

Baxter J.S., Leavy O.C., Dryden N.H., Maguire S., Johnson N., Fedele V., Simigdala N., Martin L.A., Andrews S., Wingett S.W., Assiotis I., Fenwick K., Chauhan R., Rust A.G., Orr N., Dudbridge F., Haider S, & Fletcher O. (2018). Capture Hi-C identifies putative target genes at 33 breast cancer risk loci. Nature Communications, 9, 1028.

+ Open protocol

+ Expand

6

Efficient Enrichment of Targeted Loci for Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 8

This example shows how sequence capture allows for enrichment of loci of interest prior to sequencing and thus more efficient use of the sequencing run.

Materials and Methods:

Sequence capture was performed during library preparation by hybridising the library fragments to probes which are specific to the regions of interest (See FIG. 14). A custom probeset was designed which was specific to the lambda phage genome, consisting of 120 nt oligos tiled at 1-base intervals and which was synthesised by Agilent. Lambda genomic DNA was mixed with E. coli DNA with the genomes mixed in equimolar ratios. The genomic DNA was fragmented to approx 2 kb using Fragmentase. Sequence capture was performed following Agilent's standard SureSelect protocol, with PCR extension times adjusted to accounts for the longer fragments. The resulting library was then analysed using the nanopore system.

Results:

Lambda DNA constituted approximately 1% of the starting DNA but after capture we obtained 70% of reads on target.

Sequence capture is useful when analysis of the entire genome is not desired or where the genome is too large for the throughput of the sequencer. The regions of interest may be longer in total than would be realistic to enrich by PCR, or too many PCRs may be required. Sequence capture saves money and time on sequencing and data analysis.

US10724073B2. Methods for delivering an analyte to transmembrane pores (2020-07-28). Oxford Nanopore Technologies Ltd. [GB]. Inventors: Clive Gavin Brown [GB], Daniel Ryan Garalde [GB], Andrew John Heron [GB], Daniel John Turner [GB], James White [GB].

+ Open protocol

+ Expand

7

Targeted Sequencing of Breast Cancer Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The target region for sequencing of the candidate breast cancer susceptibility genes were selected based on coding exons. For established genes, intragenic regions were also included. Baits for solution based hybrid selection capture^{32 (link)} were designed using the Agilent SureSelect design tool (https://earray.chem.agilent.com/suredesign/). 500 nanograms of high molecular weight DNA was fragmented using a Covaris E-220. Fragmentation was verified by bioanalyzer. Library preparation was performed using the NEBNext Ultra DNA Library Prep kit (E7370L), and NEB Dual indexed adapters. Fragmented DNA (mean fragment size 300 ± 20 bp) was end repaired, adapter ligated, and size selected using Ampure XP /SPRI (A63881) and was PCR amplified for eight cycles. A post-PCR clean-up was performed and enrichment for targets was performed using the Agilent SureSelect protocol. Yields were assessed using BioAnalyzer. The mean library size was 300 ± 10 bp. NGS was performed on an Illumina HiSeq 2000 to an estimated 100× mean coverage for the target region to yield paired-end reads of 100 bp per sample, using 24 samples/lane.

Slavin T.P., Maxwell K.N., Lilyquist J., Vijai J., Neuhausen S.L., Hart S.N., Ravichandran V., Thomas T., Maria A., Villano D., Schrader K.A., Moore R., Hu C., Wubbenhorst B., Wenz B.M., D’Andrea K., Robson M.E., Peterlongo P., Bonanni B., Ford J.M., Garber J.E., Domchek S.M., Szabo C., Offit K., Nathanson K.L., Weitzel J.N, & Couch F.J. (2017). The contribution of pathogenic variants in breast cancer susceptibility genes to familial breast cancer risk. NPJ Breast Cancer, 3, 22.

+ Open protocol

+ Expand

8

Sequence Capture for Targeted Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 8

This example shows how sequence capture allows for enrichment of loci of interest prior to sequencing and thus more efficient use of the sequencing run.

Materials and Methods:

Sequence capture was performed during library preparation by hybridising the library fragments to probes which are specific to the regions of interest (See FIG. 14). A custom probeset was designed which was specific to the lambda phage genome, consisting of 120 nt oligos tiled at 1-base intervals and which was synthesised by Agilent. Lambda genomic DNA was mixed with E. coli DNA with the genomes mixed in equimolar ratios. The genomic DNA was fragmented to approx 2 kb using Fragmentase. Sequence capture was performed following Agilent's standard SureSelect protocol, with PCR extension times adjusted to accounts for the longer fragments. The resulting library was then analysed using the nanopore system.

Results:

Lambda DNA constituted approximately 1% of the starting DNA but after capture we obtained 70% of reads on target.

Sequence capture is useful when analysis of the entire genome is not desired or where the genome is too large for the throughput of the sequencer. The regions of interest may be longer in total than would be realistic to enrich by PCR, or too many PCRs may be required. Sequence capture saves money and time on sequencing and data analysis.

US11613771B2. Methods for delivering an analyte to transmembrane pores (2023-03-28). Oxford Nanopore Technologies PLC [GB]. Inventors: Clive Gavin Brown [GB], Daniel Ryan Garalde [GB], Andrew John Heron [GB], Daniel John Turner [GB], James White [GB].

+ Open protocol

+ Expand

9

Efficient Enrichment of Targeted Loci for Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 8

This example shows how sequence capture allows for enrichment of loci of interest prior to sequencing and thus more efficient use of the sequencing run.

Materials and Methods:

Sequence capture was performed during library preparation by hybridising the library fragments to probes which are specific to the regions of interest (See FIG. 14). A custom probeset was designed which was specific to the lambda phage genome, consisting of 120 nt oligos tiled at 1-base intervals and which was synthesised by Agilent. Lambda genomic DNA was mixed with E. coli DNA with the genomes mixed in equimolar ratios. The genomic DNA was fragmented to approx 2 kb using Fragmentase. Sequence capture was performed following Agilent's standard SureSelect protocol, with PCR extension times adjusted to accounts for the longer fragments. The resulting library was then analysed using the nanopore system.

Results:

Lambda DNA constituted approximately 1% of the starting DNA but after capture we obtained 70% of reads on target.

Sequence capture is useful when analysis of the entire genome is not desired or where the genome is too large for the throughput of the sequencer. The regions of interest may be longer in total than would be realistic to enrich by PCR, or too many PCRs may be required. Sequence capture saves money and time on sequencing and data analysis.

US10760114B2. Methods for delivering an analyte to transmembrane pores (2020-09-01). Oxford Nanopore Technologies Ltd. [GB]. Inventors: Clive Gavin Brown [GB], Daniel Ryan Garalde [GB], Andrew John Heron [GB], Daniel John Turner [GB], James White [GB].

+ Open protocol

+ Expand

10

Optimized Hi-C Target Enrichment Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Target enrichment was performed based on the SureSelect protocol (Agilent) but incorporating the following modifications: (1) Biotinylated Hi-C ditags bound to streptavidin-beads were amplified prehybridization directly from beads using 24 parallel 25-µL PCR reactions with six to eight cycles using Phusion High-Fidelity DNA polymerase (New England Biolabs) to yield ∼500 ng total DNA. PCR primers to the paired-end adaptors were as described in Belton et al. (2012) (link). Subsequently, PCR products were pooled, purified using Agencourt AMPure XP beads (Beckman Coulter) and dried using a speedvac concentrator, then resuspended in 34 µL of water. (2) Enriched fragments were amplified post-hybridization again directly from the streptavidin beads, using 13 parallel 25-µL reactions of six cycles of PCR. PCR products were again pooled and purified using Agencourt AMPure XP beads (Beckman Coulter).

Dryden N.H., Broome L.R., Dudbridge F., Johnson N., Orr N., Schoenfelder S., Nagano T., Andrews S., Wingett S., Kozarewa I., Assiotis I., Fenwick K., Maguire S.L., Campbell J., Natrajan R., Lambros M., Perrakis E., Ashworth A., Fraser P, & Fletcher O. (2014). Unbiased analysis of potential targets of breast cancer susceptibility loci by Capture Hi-C. Genome Research, 24(11), 1854-1868.

+ Open protocol

+ Expand

Sureselect protocol

Lab products found in correlation

10 protocols using sureselect protocol

Targeted Sequencing of Conifer DNA

Customized Adapters for Illumina Sequencing

Capture Hi-C Library Preparation and Target Enrichment

Exome Sequencing from Whole Blood

Hi-C Library Enrichment and Amplification

Efficient Enrichment of Targeted Loci for Sequencing

Targeted Sequencing of Breast Cancer Genes

Sequence Capture for Targeted Sequencing

Efficient Enrichment of Targeted Loci for Sequencing

Optimized Hi-C Target Enrichment Protocol

About PubCompare

Ready to get started?