Total RNA was purified from the venom glands of T. oblongus using Trisol® Reagent (Ambion, Canada) according to manufacturer protocol. Total cDNA was synthesized from 5 μg of total RNA, using the MINT kit (Evrogen, Russia) following the manufacturer recommendations. Rapid amplification of cDNA ends was carried out using the universal primer T7cap (GTA ATA CGA CTC ACT ATA GGG CAA GCA GTG GTA ACA ACG CAG AGT) and degenerated primers To1 (TGT GCC AGC AAG AAY GAR MGN TGY GGN AAY) and To2 (GCG AGC AAG AAT GAR MGN TGY GGN AAY GCN) for 3′-terminus determination (3′-RACE) and To3 (ACG CGC AGT TTC TTR CTY KCN ACR CCN) for 5′-terminus determination (5′-RACE). DNA sequencing was carried out on ABI PRISM 3100-Avant.
Trisol reagent
Manufactured by Thermo Fisher Scientific
Sourced in United States
Trisol reagent is a solution used for the extraction and purification of RNA from biological samples. It contains a mixture of guanidinium thiocyanate, phenol, and chloroform which facilitates the separation of RNA from DNA and proteins during the extraction process.
Automatically generated - may contain errors
Lab products found in correlation
Dynabeads mrna purification kit, by Thermo Fisher Scientific (2 mentions)
Nebnext mrna library prep reagent set, by New England Biolabs (2 mentions)
Bioanalyser, by Agilent Technologies (2 mentions)
Rna 6000 nano kit, by Agilent Technologies (2 mentions)
Superscript preamplification system, by Thermo Fisher Scientific (2 mentions)
Abi prism 7500, by Thermo Fisher Scientific (2 mentions)
Rna isolation kit, by Qiagen (2 mentions)
Primescript rt master mix, by Takara Bio (2 mentions)
Probefinder software, by Roche (2 mentions)
Lightcycler 480, by Roche (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Mint kit, by Evrogen (1 mentions)
Rna clean and concentrator kit, by Zymo Research (1 mentions)
Faststart universal sybr green master rox kit, by Roche (1 mentions)
Superscript 4 vilo master mix, by Thermo Fisher Scientific (1 mentions)
Expression suite software, by Thermo Fisher Scientific (1 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taqtm, by Takara Bio (1 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (1 mentions)
19 protocols using trisol reagent
1
T. oblongus Venom Gland Transcriptome Analysis
2
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 5 × 107 cells using the TRIsol reagent (Ambion) according to the manufacturer’s protocol. RNA (10 μg) was treated with 10 U (30 min at 37°C) of RNase-free DNase I (Bio-Rad) and subsequently cleaned using the RNA clean and concentrator kit (Zymo Research). The High Capacity cDNA Reverse Transcription Kit with RNase inhibitor (Ambion) and the Multi-Scribe Reverse Transcriptase were used to convert total RNA (500 ng) to cDNA. RT-PCR was performed in 10 μl reactions containing 1 μl cDNA template, 5 μl FastStart universal SYBR Green master (Rox) kit (Roche Diagnostics, Indianapolis, IN), 300 nM forward and reverse primers each, and nuclease-free water. Primers used for this analysis are listed in Supplemental Table 1. All data were normalized to GAPDH. The normalized values from induced samples were compared against uninduced controls for the relative expression levels of mRNA. Relative mRNA levels shown in Figure 5B are represented as means of three separate RNAi induction experiments.
3
RNA Isolation and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells for RNA isolation were collected from R plates grown in bright light for 2 days at 25°C. RNA was prepared using Trisol Reagent (Ambion, 15596018, lot #265712) and quality was assessed using a 0.8% agarose gel. cDNA was generated using SuperScript IV VILO MasterMix (Invitrogen, 11756060, lot #00837183) [112 (link)]. Primers in S1 Table were used to detect cDNA.
4
Quantitative Analysis of Glycosphingolipid Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A ~50-mg piece of skin tissue was homogenized from each mice and total RNA was isolated using TRIsol reagent according to the manufacturer’s instructions (Invitrogen, Camarillo, CA). Two microgram of RNA were reverse transcribed with SuperScript II using random primers. The primer sequence for GalT-V were as follows:
LacCerS CATGAACACCTCCCGATCTT, TTCATGGCCTCTTTGAAACCCCTGCCAGCTCCTTTTTCTGATG, CCTGCAGGCTTCTTCCATAG
GlcCerS AGTGTGTGACGGGGATGTCT, CTTCCGCAATGTACTGAGCA
GAPDH GGATCCACCACAGTCCATGCCATCAC, AAGCTTTCCACCACCCTGTTGCTGTA.
The primers were synthesized by Integrated DNA Technologies (Coralville, USA). Real time PCR were performed using SYBR Green PCR Master Mix PCR Master Mix (applied Biosystems, Foster City, CA, USA) in an Applied Biosystems Step one Real time PCR system as described previously25 (link). Data were normalized to GAPDH mRNA levels. Expression suite software (Applied Biosystems) was used to analyze the data.
The primers were synthesized by Integrated DNA Technologies (Coralville, USA). Real time PCR were performed using SYBR Green PCR Master Mix PCR Master Mix (applied Biosystems, Foster City, CA, USA) in an Applied Biosystems Step one Real time PCR system as described previously25 (link). Data were normalized to GAPDH mRNA levels. Expression suite software (Applied Biosystems) was used to analyze the data.
5
Quantification of miR-9 Expression in CHO and P19 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of miR-9 was quantified by quantitative reverse polymerase chain reaction (qRT-PCR) using the total RNA obtained from CHO and P19 cells on the differentiation day. Total RNA was isolated from CHO and P19 cells using Trisol reagent (Invitrogen, Grand Island, NY). For qRT-PCR of mRNAs, 500 ng of RNA sample were reverse transcribed using the SuperscriptTM III first-strands synthesis system (Invitrogen, Grand Island, NY) for cDNA synthesis. The qRT-PCR was performed in triplicate using an iCycer (Bio-Rad, Hercules, CA) and SYBR Premix Ex TaqTM (2×; Takara, Japan) at 95°C for 3 m and 40 cycles of 95°C for 15 s and 62°C for 30 s. The relative amounts of each mRNA were normalized versus β-actin primer.
For qRT-PCR of miRNAs, 200 ng of RNA were performed by using miR-Q-assay21 (link). Each miRNA expression was represented relative to the expression of small RNA 5S rRNA, which was used as an internal control of the qRT-PCR. The expression data were presented as means of relative expression values obtained from three samples with standard deviation. For the comparison of the mean, a t-test was performed with a p-value of 0.005 as significance.
For qRT-PCR of miRNAs, 200 ng of RNA were performed by using miR-Q-assay21 (link). Each miRNA expression was represented relative to the expression of small RNA 5S rRNA, which was used as an internal control of the qRT-PCR. The expression data were presented as means of relative expression values obtained from three samples with standard deviation. For the comparison of the mean, a t-test was performed with a p-value of 0.005 as significance.
6
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the liver, muscle, and interscapular brown adipose tissue (BAT) using TRIsol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. DNase digestion was used to remove any DNA contamination and RNA was re-precipitated in ethanol to ensure no phenol contamination. For quality control, RNA purity and integrity were evaluated using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Equal amount of RNA from each of the study groups were pooled to normalize individual differences. The total RNA was converted to cDNA using the QuantiTect Reverse Transcription Kit (Qiagen Hilden, Germany). mRNA expression was quantified by a quantitative real-time polymerase chain reaction (PCR) using the QuantiTect SYBR Green PCR kit (Qiagen) and the CFX96 real-time system (Bio-Rad, Hercules, CA, USA). Each cDNA sample was amplified using primers for the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene labeled with SYBR green dye. Amplification was performed as follows: 10 min at 90 °C, and 60 s at 60 °C for a total of 40 cycles. The cycle threshold (Ct) was obtained as the cycle which a statistically significant. Using the 2ΔΔCt, the fold-changes were calculated.
7
Quantitative Analysis of Cellular Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured cells using the TRIsol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. One microgram of RNA was reverse-transcribed using Maxime RT Premix Kit (iNtRON Biotechnology, Korea). cDNA was amplified using the following primer sets: COX-1 (sense) 5′-GCT ATT CCG GCC CCA ACT-3′ (antisense) 5′-GAT GAA GGT GGC ATT GAC AAA CT-3′, COX-2 (sense) 5′-TCC TTG CTG TTC CCA CCC ATG-3′ (antisense) 5′-CAT CAT CAG ACC AGG CAC CAG-3′, MMP-1 (sense) 5′-GAA GGA GAT GAA GCA GCC CAG ATG T-3′ (antisense) 5′-CAG TTG TGG CCA GAA AAC AGA AGT GAA A-3′, MMP-3 (sense) 5′GAC ACC AGC ATG AAC CTT GTT-3′ (antisense) 5′-GGA ACC GAG TCA GGA CTA TG-3′, TIMP-1 (sense) 5′-CCT TCT GCA ATT CCG ACC TCG TC-3′ (antisense) 5′-CGG GCA GGA TTC AGG CTA TCT GG-3′, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (sense) 5′-ACC ACA GTC CAT GCC ATC AC-3′ (antisense) 5′-TCC ACC ACC CTG TTG CTG TA-3′. PCR products were electrophoresed by using 1% agarose gels and visualized by staining with ethidium bromide. Densitometric analysis was performed on the relative intensity of each band using the Multi Gauge program, version 3.0 (Fuji film, Tokyo, Japan).
8
RNA Extraction and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using a Trisol reagent® (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. Complementary DNA (cDNA) was synthesized from 5 µg of total RNA with Moloney murine-leukaemia virus (MMLV) Reverse Transcriptase (Promega, Madison, WI, USA) using a random hexamer (Bioneer, Daejeon, Korea) at 42℃ for one hour. Template cDNA was subjected to PCR amplification using gene-specific sense and antisense primers (Table 1 ). RT-PCR conditions were denatured at 95℃ for 5 minutes, followed by 28 to 35 cycles of 95℃ for 30 seconds, annealed at 57℃ for 30 seconds in a thermal cycle. The PCR products were visualized by electrophoresis on 1.5% agarose gel.
Real-time PCR was performed with the SYBR Green I Light cycle system (Roche, Mannheim, Germany). The reaction mixtures were prepared using Light Cycle Fast DNA master mixture for SYBR Green I, 0.5 µM of each primer, 4 mM MgCl2 and 2 µL of cDNA in a final volume of 20 µL. The reaction condition consisted of denaturation at 95℃ for 10 minutes, followed by 40 cycles of 95℃ for 10 seconds and 60℃ for 10 seconds, followed by melting curve analysis. For each sample, PCR were performed in duplicate. The quantitative amount of each gene was normalized against the house-keeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
Real-time PCR was performed with the SYBR Green I Light cycle system (Roche, Mannheim, Germany). The reaction mixtures were prepared using Light Cycle Fast DNA master mixture for SYBR Green I, 0.5 µM of each primer, 4 mM MgCl2 and 2 µL of cDNA in a final volume of 20 µL. The reaction condition consisted of denaturation at 95℃ for 10 minutes, followed by 40 cycles of 95℃ for 10 seconds and 60℃ for 10 seconds, followed by melting curve analysis. For each sample, PCR were performed in duplicate. The quantitative amount of each gene was normalized against the house-keeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
9
Transcriptome Analysis of Gill Tissue in Marine and Freshwater Fish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction and sequencing of mRNA and RNA-seq analysis were described in26 (link).
Four fish from marine population and four fish from freshwater population were taken for transcriptome analysis. Gills were isolated and fixed with IntactRNA® reagent (Evrogen).
Total RNA was extracted from the samples with Trisol reagent according to the manufacturers instructions (Invitrogen). Quality was checked with the BioAnalyser and RNA 6000 Nano Kit (Agilent). PolyA RNA was purified with Dynabeads® mRNA Purification Kit (Ambion). An Illumina library was made from polyA RNA with NEBNext® mRNA Library Prep Reagent Set (NEB) according to the manual. Paired-end sequencing was performed on HiSeq. 1500 with 2 × 75 bp read length. Approximately 25 million reads were generated for each sample.
Reads were mapped to gasAcu1 genome with tophat2 software (version 2.1.0)27 (link). Number of RNA-seq reads, number of unmapped reads and mapping efficiency is summarized in Supplementary tableS6 . Gene models of non-overlapping exonic fragments were taken from ENSEMBL 54 database. For each exonic fragment total coverage by mapped reads in each sample was calculated with bedtools multicov tool (version 2.17.0). Total gene coverage was calculated as a sum of coverages of all non-overlapping exonic fragments of a gene.
Four fish from marine population and four fish from freshwater population were taken for transcriptome analysis. Gills were isolated and fixed with IntactRNA® reagent (Evrogen).
Total RNA was extracted from the samples with Trisol reagent according to the manufacturers instructions (Invitrogen). Quality was checked with the BioAnalyser and RNA 6000 Nano Kit (Agilent). PolyA RNA was purified with Dynabeads® mRNA Purification Kit (Ambion). An Illumina library was made from polyA RNA with NEBNext® mRNA Library Prep Reagent Set (NEB) according to the manual. Paired-end sequencing was performed on HiSeq. 1500 with 2 × 75 bp read length. Approximately 25 million reads were generated for each sample.
Reads were mapped to gasAcu1 genome with tophat2 software (version 2.1.0)27 (link). Number of RNA-seq reads, number of unmapped reads and mapping efficiency is summarized in Supplementary table
10
RNA-seq of Caki-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from Caki-1 cells with Trisol reagent according to the manufacturer’s instructions (Invitrogen). Quality was checked with BioAnalyser and RNA 6000 Nano Kit (Agilent). PolyA RNA was purified with Dynabeads
® mRNA Purification Kit (Ambion). An Illumina library was made from polyA RNA with NEBNext
® mRNA Library Prep Reagent Set (NEB) according to the manual. Sequencing was performed on HiSeq1500 with 50 bp read length. 10 million reads were generated for each sample.
® mRNA Purification Kit (Ambion). An Illumina library was made from polyA RNA with NEBNext
® mRNA Library Prep Reagent Set (NEB) according to the manual. Sequencing was performed on HiSeq1500 with 50 bp read length. 10 million reads were generated for each sample.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!