The largest database of trusted experimental protocols

Dmem low glucose

Manufactured by Nacalai Tesque
Sourced in Japan

DMEM (low glucose) is a cell culture medium formulation designed to support the growth and maintenance of various cell lines. It contains a lower concentration of glucose compared to standard DMEM, which may be more suitable for certain cell types. The core function of DMEM (low glucose) is to provide a balanced nutrient solution to sustain cell viability and proliferation in in vitro cell culture applications.

Automatically generated - may contain errors

11 protocols using dmem low glucose

1

Preparation and Conjugation of Fatty Acid-BSA Complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bovine serum albumin (BSA)‐conjugated PA, 2‐PG, and 3‐PG were prepared as previously described [26 (link)]. Briefly, 500 mmol·L−1 of each fatty acid/monoacylglycerol was dissolved in ethanol at 55 °C. Meanwhile, 10% free fatty acid (FFA)‐free BSA was dissolved in Dulbecco's modified Eagle's medium (DMEM) containing 1.0 g·L−1 glucose (DMEM low glucose; NACALAI TESQUE, Kyoto, Japan) at 37 °C and subsequently filtered through Millex‐GV Syringe Filter with a 0.22 μm pore size hydrophilic polyvinylidene difluoride membrane (Merck Millipore, Burlington, USA). Each of the dissolved fatty acid/monoacylglycerols was mixed with 10% FFA‐free BSA in a 1 : 100 ratio, vortexed, and incubated at 55 °C for 15 min, followed by a 15 min conjugation in a water sonicator, until the fatty acid/monoacylglycerol‐BSA was dispersed. The vehicle control was prepared by mixing ethanol and 10% FFA‐free BSA in a 1 : 100 ratio. Fatty acid/monoacylglycerol‐BSA and the vehicle control were stored at −20 °C and melted in a water bath at 55 °C prior to use; thereafter, they were diluted in DMEM low glucose (NACALAI TESQUE) with 10% fetal bovine serum (Biowest, Nuaille, France) and 1% of Penicillin–Streptomycin‐Amphotericin B suspension (Wako, Odawara, Japan) to 100 or 120 μmol·L−1. The vehicle control was diluted in the same manner as the fatty acid/monoacylglycerols.
+ Open protocol
+ Expand
2

Glycolipid Preparation and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols
Ceramide species (16:0, 24:0, 24:1) and GlcCer species (16:0, 24:1) were from Avanti Polar Lipids (Alabaster, AL, USA). GlcCer (24:0), LacCer (16:0, 24:0, 24:1), and GM3 (16:0, 18:0, 20:0, 22:0, 24:0, h24:0, 24:1) and GM1 (18:0) were synthesized as described previously (Murase et al, 1989; Mauri et al, 1999). GM2 (from brain of Tay‐Sachs disease patient) was from Matreya (State College, PA, USA). Brain GD1a, GD1b, and GT1b were from Sigma‐Aldrich (St. Louis, MO, USA). Brain GQ1b was from AdipoGen Life Sciences (San Diego, CA, USA). Milk GD3 was from Nagara Science Co. (Gifu, Japan). Ceramides, GlcCer, and LacCer species were dissolved at 1 mM in warmed DMSO. Gangliosides were dissolved at 0.5 mM concentration in warmed low‐glucose DMEM (Nacalai Tesque; Kyoto, Japan). Stock solutions were stored at −30°C and diluted with low‐glucose DMEM to 100 μM concentration prior to experiments.
+ Open protocol
+ Expand
3

Culturing Vero, 293T, and Human iPSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Vero cells were cultured in low-glucose DMEM (Nacalai Tesque, Kyoto, Japan) supplemented with 2% fetal calf serum (FCS). 293T cells were cultured in high-glucose DMEM (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% FCS. Human iPSCs 110 (BYS0110), 112 (BYS0112), and 116 (BYS0116), were obtained from ATCC (Manassas, VA, USA). BMI and BM9 were obtained from WiCell (Madison, WI, USA). 201B7 and 409B2 were obtained from the Riken Bioresource Center (Ibaraki, Japan). Epi was obtained from Thermo Fisher Scientific. Epi, BMI, BM9, 110, 112, and 116 were maintained on Corning Matrigel hESC-Qualified Matrix (CORNING, Corning, NY, USA) in mTeSR 1 medium (STEMCELL Technologies, Vancouver, BC, Canada). 201B7 and 409B2 were cultured on vitronectin (Thermo Fisher Scientific) in ReproFF2 medium (ReproCELL, Kanagawa, Japan) supplemented with 5 ng/mL basic fibroblast growth factor (bFGF; ReproCELL). T-705, Y27632, and puromycin were purchased from Selleckchem (Houston, TX, USA), FUJIFILM Wako Pure Chemical (Osaka, Japan), and InvivoGen (San Diego, CA, USA), respectively.
+ Open protocol
+ Expand
4

PC12 Cell ATP Production Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
PC12 cells were cultured with low glucose D-MEM (Nacalai Tesque, Kyoto, Japan), supplemented with 10% FBS (Sigma) and 5% horse serum (Sigma). 7.5 × 104 PC12 cells were treated with 50 ng/mL NGF (Alomone labs, Jerusalem, Israel) for 24 h, then antimycin (Sigma), oligomycin (Sigma), and KUSs were added as indicated in Results, and cells were cultured for another 20 or 28 h. ATP in cultured cells was measured with an ARVO multilabel counter, using a luciferase-based ATP assay reagent for cells (Toyo B-net, Tokyo, Japan). For western blotting, 15 μg whole cell extracts were loaded per lane.
+ Open protocol
+ Expand
5

Cell Culture Maintenance and Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
All cultured cells were maintained at 37°C under 5% CO2 and 100% humidity. HEK293A cells (Invitrogen, Carlsbad, CA) were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Nacalai, Kyoto, Japan) containing 10% fetal bovine serum (FBS) and penicillin/streptomycin (Nacalai). Vero cells stably expressing BoDV G (Vero-BG) and Vero REVec-GFP cells were cultured in low-glucose DMEM (Nacalai Tesque, Kyoto, Japan) supplemented with 2% FBS. 293T cells were cultured in high-glucose DMEM (Thermo Fisher Scientific, Waltham, MA) supplemented with 10% FBS. The FuGene HD transfection reagent (Promega) was used for plasmid transfection. At 48 h after transfection, the cells were treated for various analyses, as indicated.
+ Open protocol
+ Expand
6

Establishing Stable Cell Lines with Flp-In/T-REx HEK293

Check if the same lab product or an alternative is used in the 5 most similar protocols
Flp-In/T-REx HEK293 (Life Technologies) and intact HEK293 cells were maintained in low-glucose DMEM (Nacalai Tesque) supplemented with 10% fetal bovine serum (FBS; Nichirei Biosciences), 100 U ml−1 of penicillin and 100 μg ml−1 of streptomycin (Nacalai Tesque). Cells were transfected with plasmid DNAs using polyethylenimine MAX (Polysciences) as described previously50 (link), then selected with hygromycin B (Life Technologies) for the pcDNA5/FRT/TO vectors and/or with puromycin (Nacalai Tesque) for the pCAGIPuro vectors to establish stable cell lines.
+ Open protocol
+ Expand
7

Culture and Maintenance of Hepatic Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
HepG2 cells and their derivatives (NTCP-expressing HepG2 cells [NTCP/HepG2]) were maintained in a Williams’ B culture medium (Gibco)-based PMM (primary hepatocyte maintaining medium), which contained 10% fetal bovine serum (FBS), 100 IU/mL penicillin, 100 µg/mL streptomycin and 0.25 µg/mL amphotericin B (Nacalai Tesque, San Diego, CA, USA), 50 µM hydrocortisone (Sigma-Aldrich), 5 µM dexamethasone, 5 µg/mL transferrin (Wako Pure Chemicals), 10 ng/mL EGF (ThermoFisher, Waltham, MA, USA), 5 µg/mL insulin (Sigma-Aldric), 5 ng/mL sodium selenite, 2 mM L-glutamine (Nacalai Tesque), and 0.5 mg/mL G418 (Nacalai Tesque). NTCP-expressing HepG2 cells were the kind gift of Dr. Watashi [43 (link),44 (link)] and were maintained in the same PMM but with the addition of 0.5 mg/mL G418 (Nacalai Tesque). HEK293T cells were cultured in Dulbecco’s modified Eagle media (DMEM) (high glucose) (Nacalai Tesque) supplemented with 10% FBS, 100 IU/mL penicillin, 100 µg/mL streptomycin, and 0.25 µg/mL amphotericin B (Nacalai Tesque). All the cells were maintained in a 5% CO2 incubator (Panasonic Health Care, Tokyo, Japan). Huh6 and HB611 cells were maintained in DMEM (low glucose) (Nacalai Tesque) with the same supplements as HEK293T. In the case of HB611, G418 (Nacalai Tesque) was added to the medium at 0.5 mg/mL.
+ Open protocol
+ Expand
8

Generation of Opn5 Knockout 661W Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Murine retinal precursor cell line 661W (a kind gift from Dr. Muayyad Al-Ubaidi, University of Oklahoma Health Sciences) was cultured in culture media, Dulbecco’s modified Eagle’s medium (DMEM) low glucose (08456-65, Nacalai Tesque, Kyoto, Japan) supplemented with 10% fetal bovine serum and 1% streptomycin-penicillin at 37 °C under in a 5% CO2 incubator. To generate Opn5 KO 661W cells, the cells were transfected using Lipofectamine™ 3000 transfection reagent (L3000001, Invitrogen, CA, USA) with Opn5 or a control plasmid in culture medium without fetal bovine serum and streptomycin-penicillin. A plasmid containing the mouse Opn5 gRNA sequence (GCTCAGGTGCATAGTCCCCC) and a puromycin resistance gene was synthesized by GenScript (NJ, USA). After 48 h, cells were cultured in culture media supplemented with 2 µg/mL puromycin (P8833, Sigma-Aldrich, MO, USA) until no infected cell death. Subsequently, cells expanded into multiple colonies. The expression of Opn5 in transfected cells was estimated using PCR (Supplementary Fig. S7).
+ Open protocol
+ Expand
9

Synthesis and Characterization of Novel Compounds

Check if the same lab product or an alternative is used in the 5 most similar protocols
ALA hydrochloride and sodium ferrous citrate (SFC) were purchased from Cosmo Oil Co., Ltd. (Tokyo, Japan). Rhodamine B-{(1,10-phenanthrolin-5-yl) aminocarbonyl} benzyl ester (RPA) was purchased from Squarix biotechnology GmbH (Marl, Germany). Pyridoxal isonicotinoyl hydrazone (PIH) was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). RPMI-1640, DMEM (low-glucose), DMEM (high-glucose) media and antibiotic-antimycotic solution (ABAM) were obtained from Nacalai Tesque (Kyoto, Japan). EGM-2 BulletKit was purchased from Lonza group Ltd. (Basel, Switzerland). Fetal bovine serum (FBS) was purchased from Invitrogen (Carlsbad, CA, USA). All other chemicals were of analytical grade.
+ Open protocol
+ Expand
10

Cultivation of MDCK and VeroE6/TMPRSS2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Madin-Darby canine kidney (MDCK) cells were grown in Eagle’s minimal essential medium (E-MEM; Nacalai Tesque) supplemented with 10% fetal bovine serum (FBS), penicillin (100 U/ml), and streptomycin (100 μg/ml). VeroE6 cells stably expressing transmembrane protease serine 2 (VeroE6/TMPRSS2; JCRB Cell Bank 1819) were maintained in Dulbecco’s modified Eagle’s medium (DMEM) low glucose (catalog [cat] number 08456-65; Nacalai Tesque) supplemented with 10% FBS, penicillin (100 U/ml), streptomycin (100 μg/ml), and G418 (1 mg/ml) (39 (link)).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!