Specific pcr primers

Total RNA was extracted using TRIzol reagent (Vazyme, Nanjing, China). Subsequently, cDNAs were synthesized using Prime Script RT-polymerase (Vazyme). SYBR Green Premix (Vazyme) with specific PCR primers (Sangon Biotech, Shanghai, China) were used to detect the expression level of corresponding gene RNA. The primer sequences are provided in Supplementary Table 2. The fold-changes were calculated using the 2^−ΔΔCT method.

Total RNA was extracted from tissues using TRIzol reagent (Vazyme, Nanjing, China). PrimeScript RT-polymerase (Vazyme) was used to reverse-transcribe cDNAs corresponding to the mRNAs of interest. qRT-PCR was performed using SYBR-Green Premix (Vazyme) with specific PCR primers (Sangon Biotech Co., Ltd, Shanghai, China). Glyceraldehyde-3-phosphate dehydrogenase was used as an internal control. The 2^−ΔΔCt method was used to calculate fold-changes. Primer sequences are listed in Additional file 1: Table S1.

Total RNA was extracted from tissues and cells using TRIzol reagent (Takara, Dalian, China) based on the manufacturer’s instructions. The complementary DNAs (cDNAs) corresponding to the lncRNAs and mRNAs of interest were reverse-transcribed from 1 μg of total RNA using PrimeScript RT-polymerase (Takara). The cDNAs for the miRNAs of interest were synthesized using Mir-X^Tm miRNA First-Strand Synthesis (Clontech, Dalian, China). The qRT-PCR was performed using SYBR-Green Premix (Takara) with specific PCR primers (Sangon Biotech Co., Ltd, Shanghai, China). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and RNU6 (U6) were used as internal controls due to their stability across all groups studied. Fold changes were calculated by means of the 2^−ΔΔCt method. Primer sequences are listed in Supplementary Table S3.

TRIzol reagent (Vazyme) was used to isolate total RNA. The synthesis of cDNAs corresponding to the mRNAs of interest was conducted using PrimeScript RT‐polymerase (Vazyme), SYBR‐Green Premix (Vazyme), and specific PCR primers (Sangon). Glyceraldehyde‐3‐phosphate dehydrogenase was used as an internal control. The 2^−ΔΔCt method was used to calculate fold‐changes. The difference in the expression of ACE2 and the prognosis of ACE2 in breast cancer were explored with Student's t test and Kaplan–Meier analysis.

The immunohistochemistry staining of target genes in GBM tissues and normal tissues was obtained from The Human Protein Atlas (https://www.proteinatlas.org/), a bioinformatics tool aimed at mapping all the human proteins in cells, tissues, and organs using an integration of various omics technologies [17 ].
GBM and normal brain tissues (n = 52) were obtained from patients from the Shengjing Hospital of China Medical University. All patients provided informed consent. Each patient did not receive any treatment before operation. Total RNA of human tissues was extracted with a TRIzol reagent (Vazyme, Nanjing, China). The synthesis of cDNAs corresponding to the mRNAs of interest depended on PrimeScript RT-polymerase (Vazyme) and SYBR-Green Premix (Vazyme) with specific PCR primers (Sangon Biotech Co., Ltd., Shanghai, China). Glyceraldehyde-3-phosphate dehydrogenase was used as an internal control. The 2^−ΔΔCt method was used to calculate fold changes. Primer sequences were as follows: GAPDH, forward: GCACCGTCAAGGCTGAGAAC, reverse: TGGTGAAGACGCCAGTGGA, and CD163, forward: CTACGAACTTCAGCCAGAGTGCACCTCAT, reverse: GTCATAATGAACTTCAGCTATTGCACAC. The differences of the CD163 expression and the prognosis of CD163 in GBM were evaluated with Student's t-test and Kaplan-Meier analysis in GraphPad Prism 7 software (GraphPad, Inc., La Jolla, CA, USA).

We obtained 30 KIRC tissues and normal kidney tissues from patients who underwent tumor resection in the Affiliated Hangzhou First People’s Hospital. Histological diagnosis and tumor grade were assessed by three experienced pathologists following the 2010 American Joint Committee on Cancer (AJCC) staging system. All procedures were approved by the Ethics Committee of Affiliated Hangzhou First People’s Hospital, and informed consent was obtained from each patient.
Total RNA of clinical tissues was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc), and PrimeScript RT-polymerase (Vazyme) was used to synthesize the cDNA according to the manufacturer´s instructions. RT-qPCR was performed with SYBR-Green Premix (Qiagen GmbH) with specific PCR primers (Sangon). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. The primers of GAPDH and immune checkpoints were shown in Supplementary Table 1. The fold-change was calculated as previously described with the 2^−ΔΔCt method. The Student’s t-test was conducted to compare the expression of immune checkpoints in KIRC and normal tissues. Kaplan-Meier analysis was performed to evaluate the prognosis value of immune checkpoints in KIRC.