Lenti x rt qpcr titration kit

HEK293T cells (ATCC) were thawed and passaged a minimum of 2 times in 100 mm tissue culture dishes (Corning, 430167) with DMEM with 10% FBS and 1% penicillin-streptomycin before transfecting the cells at 85%–95% confluence with 8 μg pCDH-hTERT-T2A-Bmi-1, 8 μg psPAX, and 4 μg VSVG plasmids, using Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific, 11668-019) according to the manufacturer’s protocol. Cells were maintained at 37°C in 5% CO₂. Media were changed and collected every 24 hours for up to 72 hours and stored at 4°C. A portion of virus-containing medium was aliquoted and frozen at –80°C, and the remainder was concentrated with the Lenti-X Concentrator kit (Clontech, 631231). Viral titering was performed using 15 μL unconcentrated virus or 1.5 μL concentrated virus with the Lenti-X RT-qPCR Titration Kit (Clontech, 632165). Results were read on an ABI QuantStudio 6 RT-PCR machine.

sgRNAs were designed using the clustered regularly interspaced short palindromic repeats (CRISPR) Design Tool (http://crispr.mit.edu/) to minimize off-target effects. The KO sgRNA targeting exon 6 of UTX is 5′TATGAGTCTAGTTTAAAGGT3′. Oligos (Integrated DNA Technologies) were synthesized, annealed, and cloned into vector LentiCRISPRv2 (Addgene plasmid #52961). sgRNAs targeting the firefly luciferase gene (exons 6 and 7) were used as non-specific controls. Viral constructs were co-transfected with VSVL, REV, and HDL into 293T cells using Lipofectamine 3000 (Life Technologies) to generate lentiviruses. Lentiviral particles were harvested in mTeSR1, and titer was quantified by the Lenti-X RT-qPCR titration kit (Clontech). For lentiviral transduction, ESCs were inoculated two consecutive times with lentiviral particles (3 h for each time) and allowed to recover in mTeSR1 overnight. Puromycin (0.375 g/mL; ThermoFisher Scientific) selection started approximately 24 h after transduction.