Thermoscript rt system reagent

Manufactured by Thermo Fisher Scientific

The Thermoscript RT system reagent is a reverse transcription kit used for the conversion of RNA into complementary DNA (cDNA). It provides the necessary components to perform this fundamental step in various molecular biology applications, such as gene expression analysis and cDNA library construction.

Automatically generated - may contain errors

Lab products found in correlation

Sequence detection system 7900 abi prism 7900ht, by Thermo Fisher Scientific (3 mentions) Trizol reagent, by Thermo Fisher Scientific (3 mentions) Power sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)

Close spelling variants of this product

Thermoscript (42 citations) ThermoScript RT (30 citations) Thermoscript RT system (11 citations)

3 protocols using thermoscript rt system reagent

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were harvested, and total RNA was extracted using TRIzol Reagent (Gibco BRL, Gaithersburg, MD). RNA was reverse transcribed to cDNA with Thermoscript RT system reagent (Gibco BRL) in accordance with the manufacturer’s instructions.
Quantitative real-time PCR was performed using an Applied Biosystems Sequence Detection System 7900 (ABI Prism 7900HT, Applied Biosystems Company, USA) with a 10-µl mixture consisting of Power SYBR GREEN PCR Master Mix (Applied Biosystems, Foster City, CA), 500 nmol of each primer, and 300 ng of cDNA templates. The reactions were performed with an initial denaturation at 95 °C for 5 minutes, which was followed by 60 cycles of 20 seconds at 94 °C, 20 seconds at 60 °C, and 40 seconds at 72 °C. A final extension at 72 °C for 5 minutes was included before a temperature ramp from 72 °C to 95 °C at 0.1 °C/s with continuous fluorescent acquisition. Each cDNA sample was duplicated for each q-RT-PCR attempt, and the average relative fold mRNA expression levels were determined using the 2^−ΔΔCt method; GAPDH was the internal control. The oligonucleotide primers for FOXK1, SNAI1, SNAI2, KLF8, Sp1, Sp3, YY1, HMGA1 and GAPDH mRNA are listed in Supplementary Table 1.

Xie R., Wang J., Liu X., Wu L., Zhang H., Tang W., Li Y., Xiang L., Peng Y., Huang X., Bai Y., Liu G., Li A., Wang Y., Chen Y., Ren Y., Li G., Gong W., Liu S, & Wang J. (2017). RUFY3 interaction with FOXK1 promotes invasion and metastasis in colorectal cancer. Scientific Reports, 7, 3709.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were harvested, and total RNA was extracted using Trizol Reagent (Gibco BRL, Gaithersburg, MD). RNA was reverse transcribed to cDNA by Thermoscript RT system reagent (Gibco BRL) in accordance with the manufacturer's instructions.
Quantitative real-time PCR was performed using an Applied Biosystems Sequence Detection System 7900 (ABI Prism 7900HT, Applied Biosystems Company, USA) with a 10- μl mixture composed of Power SYBR GREEN PCR Master Mix (Applied Biosystems, Foster City, CA), 500 nmol of each primer, and 300 ng of cDNA templates. The reactions were performed with initial denaturation at 95°C for 5 minutes followed by 60 cycles of 20 seconds at 94°C, 20 seconds at 60°C, and 40 seconds at 72°C. A final extension at 72°C for 5 minutes was included before a temperature ramp from 72°C to 95°C at 0.1°C/s with continuous fluorescent acquisition. Each cDNA sample was duplicated for each time of q-RT-PCR, and the average relative fold mRNA expression levels were determined using the 2^−ΔΔC_t method, with GAPDH as the internal control. The primers used are listed in Supplementary Table S1 [44 (link), 45 (link)].

Wu Y., Peng Y., Wu M., Zhang W., Zhang M., Xie R., Zhang P., Bai Y., Zhao J., Li A., Nan Q., Chen Y., Ren Y., Liu S, & Wang J. (2016). Oncogene FOXK1 enhances invasion of colorectal carcinoma by inducing epithelial-mesenchymal transition. Oncotarget, 7(32), 51150-51162.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Vimentin Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were harvested, and total RNA was extracted using TRIzol Reagent (Gibco BRL, Gaithersburg, MD, USA). RNA was reverse-transcribed to cDNA using Thermoscript RT system reagent (Gibco BRL) in accordance with the manufacturer's instructions.
Quantitative real-time PCR was performed using an Applied Biosystems Sequence Detection System 7900 (ABI Prism 7900HT, Applied Biosystems Company, USA) with a 10-µl mixture composed of Power SYBR GREEN PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 500 nmol of each primer, and 300 ng of cDNA template. The reactions were performed with an initial denaturation at 95°C for 5 minutes, followed by 60 cycles of 20 seconds at 94°C, 20 seconds at 60°C, and 40 seconds at 72°C. A final extension at 72°C for 5 minutes was included before a temperature ramp from 72°C to 95°C at 0.1°C/s with continuous fluorescent acquisition. Each cDNA sample was processed in duplicate for each q-RT-PCR assay, and the average relative fold mRNA expression levels were determined using the 2 -ΔΔCt method with GAPDH as the internal control. The primer sequences used for q-RT-PCR were as follows: Vimentin forward: 5'-GGGACCTCTACGAGGAGGAG-3' and Vimentin reverse: 5'-CGCATTGTCAACATCCTGTC-3' (200 bp); GAPDH forward: 5'-GTCAACGGATTTGGTCGTATT-3' and GAPDH reverse: CTCCTGGAAGATGGTGATGGG (216 bp).

Wang J., Liu G., Liu M., Xiang L., Xiao Y., Zhu H., Wu X., Peng Y., Zhang W., Jiang P., Li A., Nan Q., Chen Y., Chen C., Cheng T., Liu S, & Wang J. (2018). The FOXK1-CCDC43 Axis Promotes the Invasion and Metastasis of Colorectal Cancer Cells. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 51(6).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!