Sorted DR5 binders were further engineered to increase binding affinity using random mutagenesis to the full gene and the helices of ABY in parallel by error-prone PCR using nucleotide analogues 2’-deoxy-P-nucleoside-5’-triphosphate and 8-oxo-2’-deoxyguanosine-5’- triphosphate as described40 (link). The mutagenized gene fragments were transformed into yeast with homologous recombination with linearized pCT vector. The resultant mutant ABY population underwent two rounds of MACS and a FACS against mammalian cell lysates expressing DR5ΔCD-GFP (or LAG3-GFP for comparative control). Finally, FACS sorted ABY populations were labeled with mouse c-Myc antibody, followed by AlexaFluor647-conjugated anti-mouse antibody and incubated with DR5ΔCD-GFP lysate (or LAG3 GFP lysate for comparative control) for two hours at room temperature. Binding of ABY to DR5ΔCD-GFP was detected by flow cytometry. Yeast clones that showed double positive fluorescence signals (AlexaFluor647+/GFP+) were collected. These cells were grown and zymoprepped to isolate plasmid DNA. Clonal plasmid was obtained by transforming extracted DNA into One Shot TOP10 Escherichia coli (Invitrogen). Individual colonies were grown in LB medium and plasmids were extracted from bacterial culture using the QIAGEN Miniprep Kit. Purified DNA was sequenced by ACGT, Inc.
Escherichia coli one shot top10
Manufactured by Thermo Fisher Scientific
Sourced in United States, France
The Escherichia coli One Shot® TOP10 is a competent cell line used for routine cloning and plasmid DNA propagation. It is genetically engineered to provide efficient transformation and high-quality plasmid DNA.
Automatically generated - may contain errors
Lab products found in correlation
Zero blunt topo pcr cloning kit, by Thermo Fisher Scientific (3 mentions)
Topo ta cloning kit, by Thermo Fisher Scientific (2 mentions)
Miniprep kit, by Qiagen (1 mentions)
Pcr4 vector, by Thermo Fisher Scientific (1 mentions)
Pcr2.1 topo plasmid, by Thermo Fisher Scientific (1 mentions)
Hindiii, by Thermo Fisher Scientific (1 mentions)
Platinum pfx dna polymerase, by Thermo Fisher Scientific (1 mentions)
Dneasy blood tissue kit, by Qiagen (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
E coli xl1 blue, by Agilent Technologies (1 mentions)
Isolate 2 plasmid mini kit, by Meridian Bioscience (1 mentions)
Pcr8 gw topo ta cloning kit, by Thermo Fisher Scientific (1 mentions)
Pentr d topo cloning kit, by Thermo Fisher Scientific (1 mentions)
Phusion high fidelity dna polymerase, by New England Biolabs (1 mentions)
Phusion polymerase, by New England Biolabs (1 mentions)
Pegfp c1 vector, by Addgene (1 mentions)
Pureyield plasmid miniprep system, by Promega (1 mentions)
5 3 race kit, by Roche (1 mentions)
Applied biosystems 3730xl dna analyzer, by Thermo Fisher Scientific (1 mentions)
Plvx ef1α ires puro vector, by Takara Bio (1 mentions)
22 protocols using escherichia coli one shot top10
1
Directed Evolution of ABY Binders
2
CRISPR/Cas9-mediated SAP130 Deletion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Deletions were determined by polymerase chain reaction (PCR) amplification of SAP130 flanking a projected cutting site introduced by the CRISPR/Cas9 system. The forward primer (AAAACGATCTTCAGTACGGGCACA) and reverse primer (GCCTGGAAGAAATTTTTGGATGGT) amplify an 894‐bp wild‐type amplicon. For genotyping the piglets once born, the resulting PCR products were purified and sequenced by Sanger sequencing. The PCR product was also TOPO cloned into the pCR4 vector (Invitrogen) and transformed into chemically competent One Shot TOP10 Escherichia coli (Invitrogen). Plasmids from individual colonies were sequenced by Sanger sequencing to confirm the genotypes. All gene editing experiments were approved by the Institutional Biosafety Committee.
3
TOPO Cloning and Transformation of E1/E2 Sequences
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Purified PCR products were directly ligated into pCR2.1- TOPO plasmid (Invitrogen, Carlsbad, CA, USA) and then chemically transformed into One Shot Top10 Escherichia coli (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instructions. Bacteria were plated onto Luria Bertani agar plates containing ampicillin (50–100 μg/ml). Clones with E1/E2 sequences were identified by standard blue/white screening, as well as by colony PCR and restriction enzyme cut. {We used restriction enzyme maps and applied applying the remap tool from the European bank of bionformatics (http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz ) to the sequences of the vector and E1/E2 region. Hind III (GibcoBRL, USA) was used for restriction enzyme cut, with specific one target position at 234–240 bp of the vector sequence map, according to the manufacture’s protocol. Then, 10 μl of the digestion reaction were loaded onto 1% agarose gel, fragments were separated by electrophoresis and visualized by ethidium bromide staining}.
4
Targeted Disruption of HBV Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For analysis of gene disruption in HEK 293T or HepAD38 cells, DNA was isolated using the DNeasy Blood & Tissue Kit (Qiagen). ZFN target sites were amplified using Platinum Pfx DNA polymerase (Invitrogen) and PCR primers flanking the target sequence (Table S1 ). PCR products were then sub-cloned using the Zero Blunt TOPO PCR cloning kit (Invitrogen). HBV-ZFN target sites present in the plasmids pRRL.SFFV.ZFN1-GFP, pRRL.SFFV.ZFN2-GFP and pRRL.SFFV.ZFN3-GFP were amplified using primers SFFV-F and TurboGFP-R (Table S1 ). HBV-ZFN target sites present in the integrated HBV sequence within HepAD38 cells were amplified using PCR primers ZFN1/3-F and ZFN1/3-R for target sites ZFN1 and ZFN3, or PCR primers ZFN2-F and ZFN2-R for target site ZFN2 (Table S1 ). TOPO-cloned PCR products were transformed into One Shot Top10 Escherichia coli (Invitrogen) for clonal analysis and individual colonies were picked for plasmid purification from which the clonal ZFN target sites were sequenced using T7 or SP6 sequencing primers.
5
Molecular cloning and DNA transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA constructs were kindly provided by Dr. Kristina A. Cole (Children's Hospital of Philadelphia, Philadelphia, PA) and Dr. Sumio Sugano (University of Tokyo, Tokyo, Japan). All constructs were amplified by transformation of One Shot TOP10 Escherichia coli (Invitrogen) and validated by DNA sequencing (Supporting Table S1 ) after DNA purification (Nucleobond Xtra plasmid maxiprep kit; Macherey Nagel, Hoerdt, France). DNA transfection was performed by using Lipofectamine 2000 (Invitrogen).
6
Soluble scFv Production and scFv-Fc Fusion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To allow for the production of soluble scFv, not displayed on phage, genes encoding isolated scFv were transferred in a single cloning step into a production vector 23 (link). After ligation, the DNA was transformed into chemically competent One Shot Top10 Escherichia coli (Invitrogen, Carlsbad, CA, USA).
To enable the production of scFv-Fcε fusion proteins, an antibody format previously employed and evaluated in other studies 18 (link),24 (link), the scFv-encoding genes were cloned, using NcoI and NotI, into a vector carrying a sequence encoding the second, third and fourth constant domains of human IgE 18 (link). The ligated DNA was transformed into chemically competent XL1-Blue E. coli (Agilent Technologies, Santa Clara, CA, USA).
To enable the production of scFv-Fcε fusion proteins, an antibody format previously employed and evaluated in other studies 18 (link),24 (link), the scFv-encoding genes were cloned, using NcoI and NotI, into a vector carrying a sequence encoding the second, third and fourth constant domains of human IgE 18 (link). The ligated DNA was transformed into chemically competent XL1-Blue E. coli (Agilent Technologies, Santa Clara, CA, USA).
7
Cloning and Sequencing of VviNPF2 Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding sequences (CDS) of VviNPF2.1 (VIT_06s0004g03520) and VviNPF2.2 (VIT_06s0004g03530) and their respective promoters (1.2–1.6 kb upstream of the start codon of CDS) were amplified from V. vinifera (cv. Cabernet Sauvignon) root cDNA with Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA, United States), using the primers in Supplementary Table 2 . The cloned promoter region of VviNPF2.1 is named proVviNPF2.1 (−1,206 to −1 bp), and the promoter of VviNPF2.2 is named proVviNPF2.2 (−1,551 to −1 bp) in this study. The PCR products were ligated into the entry vector pCR8 using the pCR8/GW/TOPO TA Cloning Kit (Invitrogen, Waltham, MA, United States) or the vector pENTR using the pENTR/D-TOPO Cloning Kit (Invitrogen, Waltham, MA, United States) as per the manufacturer’s instructions. One Shot TOP10 Escherichia coli (Invitrogen, Waltham, MA, United States) were transformed with the entry vectors as per the manufacturer’s instructions. Plasmids were harvested using the ISOLATE II Plasmid Mini Kit (Bioline, London, United Kingdom), and successful cloning was confirmed by Sanger sequencing.
8
Clonal Amplicon Sequencing of megaTAL Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Clonal amplicon sequencing was performed on DNA extracted from treated cells as previously described3 (link). Briefly, megaTAL target sites were amplified using Phusion polymerase (New England Biolabs), and primers HIVintF (TAGCAGGAAGATGGCCAGTA) and HIVintR (TCCTGTATGCAGACCCCAAT). PCR products were sub-cloned using the Zero Blunt TOPO PCR cloning kit (Life Technologies). TOPO-cloned PCR products were transformed into One Shot Top10 Escherichia coli (Life Technologies) for clonal analysis and individual colonies were picked for plasmid purification from which the clonal megaTAL target sites were sequenced using T7 or SP6 sequencing primers.
9
Constructs for Actin-EGFP Fusion Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pβ-actin-EGFP-rat MAL (rMAL) and human MAL (hMAL) constructs and hMAL harboring a FLAG sequence insertion in its second extracellular loop (hMAL-L2F) have been previously published [56 (link), 58 (link)]. hMAL and hMAL-L2F were subcloned and inserted into the N-terminal of GFP gene in the pβ-actin-EGFP vector. hMAL with a FLAG insertion in the first extracellular loop (hMAL-L1F) was synthesized with RsrII/XbaI restriction sites, and purchased from Genewiz, Inc. A plasmid encoding zebrafish MAL was purchased from ATCC, subcloned and inserted into the pβ-actin-EGFP vector. The pEGFP-C1 vector was purchased from Addgene and used as the GFP control. All plasmids were amplified and purified (Qiagen) in One Shot Top 10 Escherichia coli (Life Technologies). Sequence analysis and verification was performed (Macrogen USA).
10
PLAC8 5' End Amplification in ECFCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA from control ECFCs was amplified by PCR using the 5′/3′ RACE kit, 2nd generation (Roche). Reverse primers complementary to placenta-specific 8 (PLAC8) exon 3 (Supplementary Table 3 ) were used to amplify the PLAC8 5′ end. PCR products were cloned into the pCR4-TOPO vector and transformed into One Shot TOP10 Escherichia coli using the TOPO TA Cloning kit (Life Technologies). DNA was isolated using PureYield Plasmid Miniprep System (Promega, Madison, WI), sequenced by the DNA Sequencing Core (Indiana University School of Medicine) and ProteinCT Biotechnologies (Madison, WI), and analyzed using MacVector software (Cary, NC).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!