Typhoon trio system

Complexes bound to an affinity purification resin were washed into 50 mM HEPES at pH 8, 1 mM DTT, and 10 mM MgCl₂. CoA-conjugated biotin was purchased (New England Biolabs, Ipswich, MA) and CoA-conjugated Cy3 or Cy5 was prepared as described (Yin et al., 2006 (link)) and added to a final concentration of 10 μM. Labeling reactions were carried out by addition of ACP or SFP synthase (New England Biolabs) to 1 μM final concentration and incubation at room temperature for 2 hr. Following the labeling reaction, the resin was washed three times at room temperature with HLB containing 150 mM NaCl, 0.1% Triton X-100, and 0.2% CHAPS. For samples sequentially labeled with two dyes, the labeling reactions were repeated with the second dye and synthase. After the final labeling reaction and wash, complexes were eluted by incubation with 200 nM FLAG peptide or 30 μM 3′-terminal 2′,3′-dideoxyguanosine-modified displacement oligonucleotide (CTAACCCTAACTGATGACAGGTCTAG; [Schnapp et al., 1998 (link)]) for 1 hr at room temperature. Complexes bound to FLAG antibody or 2′OMe RNA oligonucleotide resin were eluted in 14 μl or 70 μl buffer, respectively. These volumes were required to normalize activity and fluorescent spot count among preparations from the same amount of input. Labeled bulk samples were analyzed by 10% SDS-PAGE and imaged on a Typhoon Trio system (GE Healthcare).

2 × 10⁵ cells were lysed in a lysis buffer (aqua dest. + 10 mM NaCl/10 mM Tris (hydroxymethyl)-aminomethan/3 mM MgCl₂/5 % NP-40) and proteins were resolved by SDS-PAGE and identified by immunoblotting. We used an affinity-purified polyclonal rabbit anti-peptide antibody directed against the C terminus of human SEC62 (self-made), a polyclonal rabbit antibody directed against the C terminus of human SOX2 (abcam pic, Cambridge, UK) and a monoclonal mouse antibody directed against the N terminus of human b-actin (Sigma-Aldrich Co., St. Louis, MO, USA). The secondary antibodies used were ECL Plex goat anti-rabbit Cy5 or anti-mouse Cy3 conjugates (GE Healthcare, Munich, Germany). Blots were imaged using the Typhoon-Trio system and Image Quant TL software 7.0 (GE Healthcare, Munich, Germany). The SEC62, SOX2 and β-actin levels were quantified and normalized against β-actin.

2 × 10⁵ HeLa cells were lysed in a lysis buffer (aqua dest. + 10 mM NaCl/10 mM Tris(hydroxymethyl)-aminomethan/3 mM MgCl₂/5 % NP-40) and proteins were resolved by SDS-PAGE and identified by immunoblotting. Antibodies used were the previously described anti-human Sec62, monoclonal anti-human β-actin (Sigma-Aldrich Co., St. Louis, MO, USA), anti-human E-cadherin Clone 24E10 (Cell signaling Technology, Cambridge, UK), anti-human vimentin Clone V9 (Dako Denmark A/S, Glostrup, Denmark) and anti-human GAPDH (sc-25778, Santa Cruz Biotechnology, Dallas, TX, USA) antibody. Secondary antibodies used were ECL Plex goat anti-rabbit Cy5 or anti-mouse Cy3 conjugates (GE Healthcare, Munich, Germany). Blots were imaged with the Typhoon-Trio system and the Image Quant TL software 7.0 (GE Healthcare, Munich, Germany). Sec62, vimentin, and β-actin levels were quantified and normalized to GAPDH.

As a quality control of the bioconjugation, sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of conjugates was performed as previously described.62 SDS-PAGE was carried out using a 4% stacking and a 10% separating gel in a Mini-Protein II apparatus (Bio-Rad Laboratories, Inc.). Samples were prepared in Tris buffer containing SDS, bromophenol blue, glycerol, and 2% β-mercaptoethanol to reduce the disulfide bond in antibody. Amersham ECL Plex fluorescent rainbow marker was used as a standard protein marker. After electrophoresis at 40 V for about 45 min followed by 80 V for about 2 h, the gel was imaged with a Typhoon TRIO System (GE Medical System) using a fluorescence channel of 532 nm (Cy3 channel) and 635 nm (Cy5 channel), and also visualized with a ChemiDoc Imaging System (Bio-Rad Laboratories, Inc.) using the UV channel. The images were merged using Image-Pro Plus 6.0 software (public software from Media Cybernetics, ; http://www.mediacy.com/). Then, the gel was stained with Coomassie Brilliant Blue, and pictures were taken using a digital camera.