Asf1a

Manufactured by Cell Signaling Technology

Sourced in United States

ASF1A is a histone chaperone protein that plays a role in chromatin assembly and disassembly during DNA replication and repair. It functions to deposit and remove histones from chromatin, thereby facilitating nucleosome formation and dynamics.

Automatically generated - may contain errors

Lab products found in correlation

E cadherin, by Cell Signaling Technology (2 mentions) Lenticrispr v2, by Addgene (1 mentions) Brca1 sirna, by Qiagen (1 mentions) Flag tag (flag), by Merck Group (1 mentions) Vinculin, by Merck Group (1 mentions) γh2ax, by Merck Group (1 mentions) β tubulin, by Merck Group (1 mentions) Brca1, by Santa Cruz Biotechnology (1 mentions) Asf1b, by Cell Signaling Technology (1 mentions) Rad51, by Abcam (1 mentions) Chemiluminescence method, by Thermo Fisher Scientific (1 mentions) Cyclin d1, by Cell Signaling Technology (1 mentions) Ripa lysis buffer, by Thermo Fisher Scientific (1 mentions) Pvdf membrane, by Bio-Rad (1 mentions) β actin, by Santa Cruz Biotechnology (1 mentions) β catenin, by Cell Signaling Technology (1 mentions) C myc, by Santa Cruz Biotechnology (1 mentions) 3 3 diaminobenzidine dab staining, by Thermo Fisher Scientific (1 mentions) C myc, by Abcam (1 mentions) Proliferating cell nuclear antigen (pcna), by Santa Cruz Biotechnology (1 mentions)

Spelling variants of this product

Anti-Asf1a (2 citations) α-ASF1A (2 citations)

4 protocols using asf1a

Chromatin Dynamics in DNA Damage Response

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antibodies used in this study are 53BP1 (catalog no.: NB100-304; Novus Biologicals), RIF1 (catalog no.: 95558S; Cell Signaling Technology), BRCA1 (catalog no.: sc-6954; Santa Cruz Biotechnology), ASF1A (catalog no.: 2990S; Cell Signaling Technology), ASF1B (catalog no.: 2902S; Cell Signaling Technology), Vinculin (catalog no.: V9131; MilliporeSigma), FLAG (catalog no.: F3165; MilliporeSigma), β-tubulin (catalog no.: T5168; MilliporeSigma), RAD51 (catalog no.: ab63801; Abcam), γH2AX (catalog no.: 05-636l; MilliporeSigma), and RPA2 (catalog no.: 2208S; Cell Signaling Technology).
siRNAs used in this study are control siRNA (catalog no.: 1022076; Qiagen), BRCA1 siRNA (catalog no.: SI02664361; Qiagen), ASF1A siRNA (catalog no.: SI04270182; Qiagen), ASF1B siRNA (catalog no.: SI04278414; Qiagen), ON-TARGETplus Human ASF1A siRNA (catalog no.: L-020222-02-0005; Dharmacon), and ON-TARGETplus Human ASF1B siRNA (catalog no.: L-020553-00-0005; Dharmacon). sgRNAs used in this study for knockdown experiments were ligated to LentiCRISPR V2 (catalog no.: 52961; Addgene) vector. sgRNA sequences are RIF1 sgRNA: GCAGACATTTCCCTCTGAAG; ASF1A sgRNA: CTAATTACTTGTACCTATCG; and ASF1B sgRNA: CTCCTGTCCATGGTAGGTGC.

Tang M., Chen Z., Wang C., Feng X., Lee N., Huang M., Zhang H., Li S., Xiong Y, & Chen J. (2022). Histone chaperone ASF1 acts with RIF1 to promote DNA end joining in BRCA1-deficient cells. The Journal of Biological Chemistry, 298(6), 101979.

+ Open protocol

+ Expand

Immunoblotting Analysis of Cell Signaling Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Proteins were extracted from cells with RIPA Lysis Buffer (Thermo Fisher Scientific). Samples were run on SDS-PAGE and transferred to the PVDF membrane (Bio-Rad, Hercules, California). The membrane was blocked with 5% non-fat milk for 2 h at room temperature. Primary antibodies of ASF1A (Cell Signaling Technology, Danvers, MA, Cat# 2990), β-actin (Santa Cruz Biotechnology, Santa Cruz, CA, Cat# sc-1615), ZEB1 (Novus Biologicals, USA), β-catenin (Cell Signaling Technology, Cat# 8480), E-cadherin (Cell Signaling Technology, Cat# 3195 s), c-Myc (Santa Cruz Biotechnology, Cat# sc-789) and cyclin D1 (Cell Signaling Technology, Cat# 92G2) were incubated with the membrane at 4 °C overnight. Secondary antibodies were incubated for 1 h at room temperature. Antibody binding was detected using chemiluminescence method (Thermo Fisher Scientific).

Liang X., Yuan X., Yu J., Wu Y., Li K., Sun C., Li S., Shen L., Kong F., Jia J., Björkholm M, & Xu D. (2017). Histone Chaperone ASF1A Predicts Poor Outcomes for Patients With Gastrointestinal Cancer and Drives Cancer Progression by Stimulating Transcription of β-Catenin Target Genes. EBioMedicine, 21, 104-116.

+ Open protocol

+ Expand

Immunohistochemical Analysis of Key Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols

Paraffin-embedded slides were deparaffinized and rehydrated, followed by antigen retrieval using citric acid buffer. Endogenous peroxidase was deactivated with hydrogen peroxide. Slides were blocked using 10% goat serum and then incubated with the corresponding primary antibodies overnight at 4 °C. After incubation with secondary antibodies for 30 min at room temperature, 3,3’-diaminobenzidine (DAB) staining (Thermo Fisher Scientific) was used to detect antigen-antibody binding. The primary antibodies used were as follows: ASF1A (1:100, Cell Signaling Technology, Cat#2990), c-Myc (1:50, Abcam, Cat#ab56), and HES1 (1:50, Cell Signaling Technology, Cat#11988).

Yin X., Zhou M., Zhang L., Fu Y., Xu M., Wang X., Cui Z., Gao Z., Li M., Dong Y., Feng H., Ma S, & Chen C. (2022). Histone chaperone ASF1A accelerates chronic myeloid leukemia blast crisis by activating Notch signaling. Cell Death & Disease, 13(10), 842.

+ Open protocol

+ Expand

Immunohistochemical Analysis of ASF1A

Check if the same lab product or an alternative is used in the 5 most similar protocols

Paraffin embedded slides were deparaffinized and rehydrated followed by antigen-retrieval using citric acid buffer. Endogenous peroxidase was deactivated by H₂O₂. Slides were blocked using 10% goat serum and incubated with the corresponding primary antibodies overnight at 4 °C. After incubation with secondary antibodies for 45 mins at room temperature, DAB staining (Thermo Fisher Scientific) was used to detect the antigen-antibody binding. The primary antibodies used were: ASF1A (Cell Signaling Technology, Cat# 2990), PCNA (Santa Cruz Biotechnology, Cat# sc-7907), and E-cadherin (Cell Signaling Technology, Cat# 3195s). The slides were examined by two of the co-authors (XL and DX) and mean values of ASF1A positive cells were presented based on the results from two observers. For each slide, a total of 200 cells in two fields were analyzed.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!