Iq5 qrt pcr system

Skin fibroblasts were cultured in the presence of different concentrations (0, 15, 30, 60 and 120 ng/ml) of chymase for 6, 12 and 24 h. Following cell culture, the total RNA was isolated using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA). qPCR was conducted using SYBR Premix Ex Taq™ (Takara Bio, Inc., Otsu, Japan) on an IQ5 qRT-PCR system (Bio-Rad Laboratories, Hercules, CA, USA). PCR amplification conditions were as follows: Initial denaturation at 95°C for 30 sec, followed by 40 cycles of amplification at 95°C for 5 sec, 55°C for 30 sec and 72°C for 60 sec. The temperature range for the dissolution curve was 65–95°C. The 2^−ΔΔCt method was used to calculate the gene expression levels of TGF-β1 relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The sequences of the specific primers were as follows: TGF-β1 (158 bp), 5′-ACACCAACTATTGCTTCAG-3′ (sense) and 5′-TGTCCAGGCTCCAAATG-3′ (antisense); GAPDH (137 bp), 5′-GCACCGTCAAGGCTGAGAAC-3′ (sense) and 5′-TGGTGAAGACGCCAGTGGA-3′ (antisense). Each PCR trial was performed with three samples and repeated a minimum of three times.

Relative quantification methods were employed to validate the transcription of DE mRNAs and DE lncRNAs. The primers are listed in Table 1. According to the manufacturer’s instructions, TRIzol reagent was used to extract the total RNA of LMH cells, and reverse transcription was then performed using M-MLV reverse transcriptase (TransGen Biotech, Beijing, China). qRT-PCR was performed using SYBR Green master mix (TransGen Biotech, Beijing, China) on an iQ5 qRT-PCR System (Bio-Rad, Hercules, CA, USA). The PCR cycling conditions were 2 min at 95 °C followed by 40 cycles of 15 s at 94 °C and 45 s at 60 °C. The differences between the target gene and reference gene were calculated using the 2^−ΔΔCt method. The relative transcription level of each gene was normalized to that of GAPDH.

Total RNA was extracted from 100 mg rice plants with RNAiso Plus reagent (Takara, Dalian, China) according to the manufacturer’s instructions. cDNA was synthesized with the iScript™ cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) using random hexamers as primers. qPCR was performed using SsoFast EvaGreen Supermix (Bio-Rad, Hercules, CA, USA) on a Bio-Rad iQ5 qRT-PCR system with gene-specific primers (Supplementary Table S1). The results were normalized to reference gene expression (UBQ10) using the 2^−ΔΔCt method reported previously [28 (link)].

TRizol reagent was used to extract the total RNA of goat cells according to the manufacturer’s instructions (Invitrogen, Waltham, MA, USA). Reverse transcription was carried out using M-MLV reverse transcriptase (Invitrogen, Waltham, MA, USA). qRT-PCR was performed using SYBR Green master mix (TransGen Biotech, China) to quantify the RNA copy numbers on an iQ5 qRT-PCR System (Bio-Rad, USA). The PCR cycling conditions were 2 min at 95 °C followed by 40 cycles of 15 s at 94 °C and 30 s at 60 °C. Relative abundance of LncRNA and mRNA transcripts were analysed and calculated by the threshold cycle method (2^−ΔΔCt). The relative expression level of each gene was normalized to housekeeping gene β-actin. All specific primers used in this study are listed in Table 1.
Table 1

qRT-PCR primers used in this study

Target gene	Forward primer (5′-3′)	Reverse primers (5′-3′)
β-actin	CACGGTGCCCATCTACGA	CTTGATGTCACGGACGATTT
IRF1-AS	GCAGCCCAGGACCAGACTT	TGATAACAGTGGGACCTTAGCTT
IRF1	GAACGGACTCTCACTCCAGC	TGGGGGACACCTGAAAGTTG
IFN-β	TGCAGAAGCAAAACTCCACT	GCACACCTGTTGTACTCCTT
ISG15	AAGCAGTTCATCGCCCAGAA	GACCCTTGTCGTTCCTCACC
MIX1	CCACCACCGACAGCTCCCCT	GCAGGTGTGGGCGTGAAGCA

According to the manufacturer^′s instructions, TRIzol reagent was used to extract the total RNA of IPEC-J2 cells, then reverse transcription was carried out using M-MLV reverse transcriptase (Invitrogen, US). qRT-PCR was performed on iQ5 qRT-PCR System (Bio-Rad, US). The primers are shown in Additional file 10:Table S10.