The largest database of trusted experimental protocols

Superscript 3 one step rt pcr system with platinum taq high fidelity kit

Manufactured by Thermo Fisher Scientific
Sourced in United States

The SuperScript® III One-Step RT-PCR System with Platinum®Taq High Fidelity kit is a reagent system for performing reverse transcription and PCR amplification in a single tube. The kit includes all the necessary components for both reactions, including a reverse transcriptase enzyme, a high-fidelity DNA polymerase, and appropriate buffers and reagents.

Automatically generated - may contain errors

4 protocols using superscript 3 one step rt pcr system with platinum taq high fidelity kit

1

Amplification of HN and F Genes by RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
The HN and F genes were amplified by reverse transcription polymerase chain reaction (RT-PCR) using the SuperScript III One-Step RT-PCR System with Platinum Taq High Fidelity kit (Invitrogen, USA) with the HN-specific primers 5'CAGTCGACGTCATGGGGAACCAGGCCTCACAA3' and 5'GAGCGGCCGCCCTATTGACAAGAATTCAGGCCAT3' and the F-specific primers 5'AATTCGGCTAGCACCATGG GCTCCAAGTCTT3' and 5'GGCACGCGTCTAGCTGCCA GAATTGACGCGCA3'. The primers were designed according to the published sequences of the genes (accession Nos. X79092 and AF048763, respectively). After reverse transcription at 45℃ for 45 min and an initial denaturation step at 94℃ for 3 min, PCR was conducted by subjecting the samples to 35 cycles of 30s at 94℃, 30s at 64℃ and 2 min at 72℃, followed by a final elongation step at 72℃ for 10 min.
+ Open protocol
+ Expand
2

Comprehensive Viral Genome Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Both complete and partial coding nucleotide sequences were determined using NGS methods: overlapping amplicons spanning either the complete genome sequence or the first part of the genome were produced from the extracted RNA (see corresponding section) using the SuperScript® III One-Step RT-PCR System with Platinum®Taq High Fidelity kit (Invitrogen) and specific primers (detailed in the supplementary Table S3). Sequencing was performed using the PGM Ion torrent technology (Thermo Fisher Scientific) following the manufacturer’s instructions. Consensus sequence determination was done using CLC genomics workbench software (CLC bio-Qiagen). Substitutions with a frequency higher than 5% were considered for the analysis of intra-population genetic diversity and major/minor variants identification (minor variants: variant frequency >5% and ≤75%; major variants: variant frequency >75%).
+ Open protocol
+ Expand
3

Isolation and Sequencing of SIVmfa Genome

Check if the same lab product or an alternative is used in the 5 most similar protocols
In 1987, PBMC from animal Mf186-76 were co-culture with H9 cells. A vial containing cell supernatant from this co-culture was obtained (a gift from R.C. Desrosiers). Viral RNA was isolated using the High Pure Viral RNA Kit (Roche USA, Indianapolis, IN). Amplicon-specific cDNAs were produced using the SuperScript III One-Step RT-PCR System with Platinum® Taq High Fidelity kit (Invitrogen, Carlsbad CA) using primers listed in S1 Table; amplicons were either sequenced directly, or TA-cloned using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA) and then sequenced. The sequence of the full-length SIVmfa genome was deposited in GenBank under the accession number KU500642. The SIVmfa vif sequence was previously reported under KF030930 [22 (link)].
+ Open protocol
+ Expand
4

NGS-Based SARS-CoV-2 Genome Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Nucleotide sequences were determined using NGS methods: overlapping amplicons spanning either the complete genome sequence or a 256 nucleotides region (nucleotide positions: 4,391–4,646) were produced from the extracted RNA using the SuperScript® III One-Step RT-PCR System with Platinum®Taq High Fidelity kit (Invitrogen) and specific primers (detailed in the Supplementary Table S7). Sequencing was performed using the PGM Ion torrent technology (Thermo Fisher Scientific) following the manufacturer’s instructions.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!