One step sybr primerscript reverse transcription pcr kit

Blood samples were collected from mouse tail tips and total RNA was extracted by the TGuide cell/tissue/plant RNA kit (Tiangen, China). Samples were analyzed using a One Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa) on Applied Biosystems QuantStudio. Each sample was measured by triplicate in three independent experiments. β-actin transcript expression was used as an internal control for quantification. The relative expression levels were calculated using standard ΔΔCt method. Primer pairs were listed as follows: for the reference gene of β-actin: forward, GGCTGTATTCCCCTCCATCG; reverse, CCAGTTGGTAACAATGCCATGT. For SFTSV Wuhan strain: forward, ATGGATAGCAGCGTCTCATCAAATC; reverse, TGAGCGCACTGTATGAGGTAGGTAA (Supplementary Table 1). Real-time PCR reactions were initiated at 42 °C for 5 min, incubated at 95 °C for 10 s, and then followed by 40 cycles of 95 °C for 5 s and 60 °C for 20 s.

Total RNA samples from pooled tissues or whole mosquitoes were extracted with Trizol (Invitrogen). Total RNA from a single mosquito was extracted by the TGuide cell/tissue/plant RNA kit (Tiangen). Quantitative PCR was performed using a One Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa) on Applied Biosystems QuantStudio. The ZIKV viral RNA levels were normalized against reference gene ribosomal protein gene S7 (RPS7). The sequences of the RPS7 primers were as follows: sense, 5′-TCAGTGTACAAGAAGCTGACCGGA; antisense, 5′-TTCCGCGCGCGCTCACTTATTAGATT. The sequences of the ZIKV MR766 primers were as follows: sense, 5′-GGGGAAACGGTTGTGGACTT; antisense, 5′-CTGGGAGCCATGCACTGATA. The following amplification program was used: reverse transcription at 42°C for 5 min with incubation at 95°C for 10 s, followed by 40 cycles of 95°C for 5 s and 60°C for 20 s. Information collection and melt curve analysis were done following the instrument’s operation manual.

Total RNA was extracted from whole blood samples uing the TIANamp Virus RNA Kit (Tiangen) following the manufacturer’s instructions. RNA samples were analyzed using a One Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa) on Applied Biosystems QuantStudio. The β-actin gene was used as the reference, and the relative expression level was calculated using the standard ΔΔ-CT method. β-Actin primer details are as follows: forward, GGCTGTATTCCCCTCCATCG; reverse, CCAGTTGGTAACAATGCCATGT. SFTSV Wuhan strain primer details are as follows: forward, ATGGATAGCAGCGTCTCATCAAATC; reverse, TGAGCGCACTGTATGAGGTAGGTAA. Real-time quantitative PCR was initiated at 42 °C for 5 min and incubated at 95 °C for 10 s, followed by 40 cycles at 5 s at 95 °C, and 20 s at 60 °C.