The largest database of trusted experimental protocols

Polybrene infection transfection reagent

Manufactured by Merck Group
Sourced in United States

Polybrene Infection/Transfection Reagent is a cationic polymer used to enhance the efficiency of viral transduction and plasmid transfection in cell culture experiments. It functions by facilitating the interaction between the cell surface and viral particles or DNA complexes, thereby promoting their uptake by the target cells.

Automatically generated - may contain errors

21 protocols using polybrene infection transfection reagent

1

Lentiviral Knockdown of MAPK14/p38α in HBMECs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral transduction of HBMECs for knockdown of MAPK14/p38α was performed directly in the vessels at the time of cell seeding. 12-well plates (Cat# 3513; Corning) were coated with rat tail collagen type I (Cat# 354236; Corning) at 5 μg/cm2 for 30 min at 37°C. HBMECs were seeded in 12-well plates at 40,000 cells/well with 1 mg/ml polybrene infection/transfection reagent (Cat# TR-1003-G; MilliporeSigma). Pooled lentiviruses were added to the corresponding wells at 0.5 ml per well. 24 h after transduction, puromycin (Cat# A1113803; Thermo Fisher Scientific) was added to the media at 2 μg/ml of final concentration. Cells were grown under puromycin selection for 2–3 d at which time cells were harvested for RNA extraction and TNF preconditioning for time course lysate collection was performed.
+ Open protocol
+ Expand
2

Chondroitinase ABC Lentiviral Transduction

Check if the same lab product or an alternative is used in the 5 most similar protocols
A plasmid containing an optimized chondroitinase ABC (CHase) sequence was generously provided by Dr. Elizabeth M. Muir80 (link). Pipe cloning was used to insert the CHase sequence into the pLenti-C-Myc-DDK-p2a-puro lentiviral gene expression vector (Origene Cat# PS100092) as previously described81 (link).
CHase lentivirus for transduction was produced by transfecting 4 × 106 HEK293T cells with 6 µg pLenti-C-Myc-DDK-p2a-puro-chABC using X-tremeGENE HP DNA transfection reagent (Millipore Sigma Cat# 6366236001) as per manufacturer’s protocols. 48 h post transfection, viral supernatant was collected, centrifuged at 200 g for 10 min and filtered through a 0.45 µm Steriflip (Millipore Sigma Cat# SE1M003M00) to remove cellular debris. 5 × 106 LNCaP cells were plated in six well plate and 18 h later, cells were transduced by replacing culture media with 1.5 mL of viral particle and 1.5 mL serum-free RPMI media, followed by Polybrene Infection/Transfection Reagent (Millipore Sigma Cat# TR-1003-G) to a final concentration of 8 µg/mL. Cells were re-transduced 24 h and 48 h after and CHase cells were selected with 5 µg/mL puromycin (Thermo Fisher Cat# A1113802).
+ Open protocol
+ Expand
3

Stable shRNA Knockdown of SDHB in hPheo1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
A total of 2×105 hPheo1 WT cells were seeded in 24 well plates and 750ul of SMARTvector Lentiviral Human SDHB shRNA (Dharmacon) were transfected using Polybrene Infection/Transfection Reagent (EMD Millipore, USA) and incubated overnight. Post-24 h, cells were rescued with ACL-4 media containing serum. At 48 h post-transfection, cells were selected via addition of 500 μg/mL of puromycin for several weeks. RNA from puromycin-resistant cells was isolated and assayed by qRT-PCR.
+ Open protocol
+ Expand
4

Transient and Lentiviral Transfection Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lipofectamine 3000 (Invitrogen, Carlsbad, USA) was used as transient transfection agent following the manufacturer’s protocol. TransIT-LT1 transfection reagent (Mirus Bio) and Polybrene Infection/Transfection Reagent (EMD-Millipore) was used for lentiviral transfection. An SF, SE and P3 Cell Line 4D-Nucleofector X Kit (Lonza) was used as the nucleofection agent following the manufacturer’s protocol. All the plasmids are submitted to addgene will be available to researchers upon request, and sequences of different superdegron constructs is included in the Supporting Information.
+ Open protocol
+ Expand
5

Lentiviral Overexpression of PDX1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Overexpression of PDX1 by the lentiviral vector was used for the genetic manipulating approach. Lentivirus carrying PDX1 was produced from the packaging of pWPT-PDX1 (Addgene plasmid #12,256; gift from Didier Trono; http://n2t.net/addgene:12256; RRID: Addgene_12256)39 (link), psPAX2 (Addgene plasmid #12,260; gift from Didier Trono; http://n2t.net/addgene:12260; RRID: Addgene_12260), and pMD2.G (Addgene plasmid #12,259; gift from Didier Trono; http://n2t.net/addgene:12259; RRID: Addgene_12259) in human embryonal kidney (HEK 293FT) cells. The supernatant containing lentiviral particles were collected at 48- and 72-h post-packaging and filtered through a 0.45 µm filter. Viral particles were harvested using a Plasmid Midiprep Plus Purification Kit (Gene Mark Bio, Taiwan) and then freshly concentrated using an Amicon Ultra Centrifugal Filter (Merck Millipore, USA).
For the transfection protocol, cells at concentration of 5 × 104 cells/well were seeded onto 24-well culture plates for 24 h and then treated with a 4 µg/mL polybrene infection/transfection reagent (Merck Millipore) for 30 min. Multiplicity of infection (MOI) at 20, 30, or 50 was used for each 24-h-transfection course.
+ Open protocol
+ Expand
6

Lentiviral Transduction of T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
CD4+ and CD8+ T cells isolated by the CliniMACS Prodigy® (see clinical-scale manufacturing) were transduced and expanded as previously described (34 (link)). Briefly, they were activated with anti-CD3/CD28 beads (Thermo Fisher Scientific, Waltham, MA, USA) at a ratio of 1:1 in TexMACS™ (Miltenyi Biotec) with 3% human serum (c.c.pro, Oberdorla, Germany) supplemented with 12.5 ng/ml IL-7 and IL-15 (PeproTech, Rocky Hill, NJ, USA). On the following day, T cells were either left untransduced or transduced with lentiviral particles by spinoculation using an MOI of 7 and addition of 5 µg/ml Polybrene Infection/Transfection Reagent (Merck Millipore, Burlington, MA, USA). The anti-CD3/CD28 beads were removed on the following day and cells were further cultivated in TexMACS™ medium supplemented with 3% human serum, 12.5 ng/ml IL-7 and IL-15 and splitting 1:2 every 2 - 3 days for a total expansion time of 12 days.
+ Open protocol
+ Expand
7

Functional Evaluation of Engineered CAR-T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Untouched CD8+ T cells were isolated (Miltenyi Biotec) from PBMCs from HLA-B*35-positive donors and activated with anti-CD3/CD28 beads (Thermo Fisher Scientific) at a ratio of 1:1 in TexMACS (Miltenyi Biotec) with 3% human serum (c.c.pro; CTL medium) supplemented with 12.5 ng/mL IL-7 and IL-15 (PeproTech). After 1 day, T cells were transduced with lentiviral particles by spinoculation using an multiplicity of infection (MOI) of 3 and addition of 5 µg/mL Polybrene Infection/Transfection Reagent (Merck). Untransduced T cells were treated equally and served as controls. The anti-CD3/CD28 beads were removed on the following day. On day 7 or 9, EGFRt+ T cells were enriched as described30 (link) or via fluorescence-activated cell sorting (FACS). After a total expansion time of 9 to 17 days, functionality of the transduced T cells was assessed by co-culturing them with target cells. For this, 5×104 target cells and effector cells according to the specified effector-to-target (E:T) ratios were seeded in 200 µL CTL medium. Since they do not express IL-12, iEGFP-expressing TÜ165 CAR-Ts (TÜ165 EGFP-TRUCKs) were expected to show the same functionality as TÜ165 CAR-Ts and were both used to compare functionality with iIL-12-secreting TÜ165 CAR-Ts (TÜ165 TRUCKs).
+ Open protocol
+ Expand
8

Lentiviral Transduction and Puromycin Selection

Check if the same lab product or an alternative is used in the 5 most similar protocols
An amount of 1 × 106 cells in 0.5 mL culture medium, supplemented with 8 μg/mL Polybrene Infection/Transfection Reagent (Merck Millipore, Burlington, MA, USA), was transduced with 50 μL concentrated LV. The cell-virus mixture was incubated at 37 °C, 5% CO2 humidified atmosphere for 6 h, during which time it was mixed by hourly gentle pipetting. Then, cells were seeded in fresh culture medium for expansion. Twenty-four hours after viral transduction, puromycin dihydrochloride (Santa Cruz Biotechnologies, Dallas, TX, USA) was added to cultures at 1 μg/mL for positive antibiotic selection of transduced cells for typically 2–4 days.
+ Open protocol
+ Expand
9

Generating Stable Cell Lines Expressing Bim Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cells were transfected with pBabe-puro (empty, wild type Bim, or phosphorylation mutant Bim) or pLVX-IRES-Neo (Clontech, Mountain View, CA, USA) constructs (empty, wild type Bim, or Bim with the BH3 domain mutation L152A/D157A ‘BH3mut’[30 (link)]) using Lipofectamine 2000 (Thermo Fisher, Waltham, MA, USA), according to the manufacturer’s instructions. Stable cell lines were generated as previously described [74 (link)]. Briefly, ΦNX-Amphotropic packaging cell lines (Nolan lab, Stanford University) were transfected with plasmid (empty pBabe or N-terminal His-tagged Bim) using Lipofectamine 2000. RPCI-WM1 cells were subjected to three rounds of infection with 0.45-µm syringe filtered (Pall) viral supernatants and Polybrene Infection/Transfection Reagent (Millipore, Burlington, MA, USA). Once cells recovered from infection they were selected with 2 µg/ml puromycin (Sigma, Burlington, MA, USA). Phosphorylation mutant versions of Bim and the BH3 mutant version were generated using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA, USA).
+ Open protocol
+ Expand
10

Lentiviral Transduction of H3.3 DKO RAW264.7 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentivirus was generated via transfection of HEK 293T cells with 3rd generation lentiviral vector (containing a H3.3 transgene and fluorescent protein tag), packaging vectors (psPAX2 and pMD2G), and the Calcium Phosphate Transfection Kit (Invitrogen). H3.3 DKO RAW264.7 cells were then transduced with lentivirus and 4 μg/mL Polybrene Infection/Transfection Reagent (Millipore) via centrifugation at 1,000xg for 90 minutes. After culturing for 3–4 days, pure populations of transduced cells were isolated via FACS sorting based on fluorescent protein expression and then stimulated with 100ng/mL LPS. For shRNA transduction, we used lentiviral vector pLVX-shRNA2 with IKKa sequences: sh#1: GCCAGATACTTTCTTTACTGA; sh#2: GGAATAAATACAGGTTCTCAG
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!