Pgex 4t 1

Manufactured by Addgene

Sourced in United States

The pGEX-4T-1 vector is a plasmid designed for the expression and purification of recombinant proteins in E. coli. It contains a glutathione S-transferase (GST) tag that can be used to purify the expressed protein using affinity chromatography. The vector also includes a tac promoter for inducible protein expression and an ampicillin resistance marker for selection.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

PGEX-4T-1 vector

5 protocols using pgex 4t 1

Plasmid Construction and Reagent Details

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmid Myc Vif was made by cloning pNL4-3–derived gene vif in pCMV-Myc plasmid from Clontech, United States, as described earlier (Arora et al., 2014 (link)). pBlue3′LTR-luc was obtained from NIH AIDS Reference and Reagent Program of NIH, MD, United States. Glutathione S-transferase (GST) Tat was generated by cloning pNL4-3 derived tat gene in pGEX-4T1 vector from Addgene. HA Tat and Flag Tat were purchased from Addgene. HA Mdm2 was purchased from Sino Biologicals, United States. HA AKT, HA KD AKT (K179A), and HA Myr AKT were kind gifts from Hui Kuan Lin, MD Anderson Cancer Center, TX, United States. Renilla luciferase plasmid was a kind gift from Vivek Natrajan, IGIB, Delhi, India. His Ub plasmid was gifted by Dimitris Xirodimas, University of Dundee. Chemicals used were AKTi (Sigma, United States), PMA (Sigma, United States), IPTG (Sigma, United States), cycloheximide (Sigma, United States), and MG132 (Sigma, United States).

Lata S., Sood V, & Banerjea A.C. (2022). Human Immunodeficiency Virus Type 1 Vif Up-Regulates the Expression of Tat via AKT Signaling Pathway: Role of Ubiquitin Specific Protease 17. Frontiers in Microbiology, 13, 828430.

+ Open protocol

+ Expand

Plasmid Constructs for Cell Studies

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following constructs were procured for the study: pGEX4T-1 (gift from Fernando Martin-Belmonte; Addgene plasmid #40059); pmCherry-C1 hSlp2-a (gift from Fernando Martin-Belmonte; Addgene plasmid #40056); pEGFP-C1 hSlp2-a C2AB (gift from Fernando Martin-Belmonte; Addgene plasmid #40051); pEGFP-C1 hSlp2-a del.SHD (gift from Fernando Martin-Belmonte; Addgene plasmid #40050); pEGFP-C1 hSlp4-a (gift from Fernando Martin-Belmonte; Addgene plasmid #40032); GFP-Rab27A (gift from William Gahl; Addgene plasmid #89237); pro-vWF-GFP/mCherry (gift from Tom Carter), and pCMV6-Angpt2 (Origene MR207970).

Francis C.R., Claflin S, & Kushner E.J. (2021). Synaptotagmin-like protein 2a regulates angiogenic lumen formation via Weibel-Palade body apical secretion of angiopoietin-2. Arteriosclerosis, thrombosis, and vascular biology, 41(6), 1972-1986.

+ Open protocol

+ Expand

Cloning and Characterization of Ubiquitin-Related Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

These plasmids were all constructed with pcDNA3.1(37680, Addgene) by our lab: HA-USP1-1-200, HA-USP1-201-785, HA-USP1-1-400, HA-USP1-401-785, Myc-PARP1-1-779, Myc-PARP1-1-638, Myc-PARP1-1-476, Myc-PARP1-1-203, Myc-PARP1-203-1014, Flag-PARP1, USP1 C90S, His-Ub, His-K6, His-K11, His-K27, His-K29, His-K33, His-K48, His-K63, Myc-PARP1-K197R, Flag-P300, Flag-GCN5, Flag-PCAF, Flag-CBP, Flag-Tip60, HA-USP1-K130Q, HA-USP1-K130R. GST-USP1 and GST-USP1 C90S plasmids were constructed with pGEX-4T-1 (129567, Addgene) by our lab. Following the instructions provided, cells were transfected with Lipofectamine 3000 (L3000075, Thermo Fisher Scientific). Chemical interventions and protein assays were conducted 48 hours post-transfection. The Myc-PARP1, HA-USP1, sh-USP1 and sh-PARP1 plasmid were constructed with Plvx-Puro vector (Bio-114923, Biobw). Then they were introduced into CCA cells via virus transfection. The sequence of sh-USP1 and sh-PARP1 list as Supplementary Table 1. Specifically, the virus was generated in HEK-293T cells using a four-plasmid transfection system (VSVG, pLP1, pLP2, target plasmid) facilitated by Lipofectamine 3000. Then the virus infect CCA or HEK-293T cell line with Polybrene (TR-1003, Sigma-Aldrich). The stable cell line was established through puromycin selection.

Zhang D.Y., Zhu Y., Wu Q., Ma S., Ma Y., Shen Z.C., Wang Z., Sun W., Zhou Y.C., Wang D., Zhou S., Liu Z., Kwong L.N, & Lu Z. (2023). USP1 promotes cholangiocarcinoma progression by deubiquitinating PARP1 to prevent its proteasomal degradation. Cell Death & Disease, 14(10), 669.

+ Open protocol

+ Expand

Lentiviral Plasmid Constructs and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

All plasmids were transfected with polyethylenimine (Polysciences, USA) according to the manufacturer’s instructions. The packaging plasmids pMD2.G (Addgene plasmid, 12259), psPAX2 (Addgene plasmid, 12260), and HEK293FT were used for producing lentivirus. The lentivirus was generated by transfecting HEK293FT cells with packaging plasmids pMD2.G and psPAX2 and targeting shRNAs or plasmids with polyethylenimine. The medium containing lentivirus was harvested with a 0.45-μm filter at 72 hours after transfection. SMYD2, Ku70, and Ku80 cDNAs were amplified, at full length, and various fragments were cloned into pLVX-Puro, pGEX4T1, pET-28b, or pEGFP-C2 vectors (Addgene, USA). Site-specific mutations were generated using a site-directed mutagenesis kit (Vazyme, China). The shRNA sequences targeted human SMYD2 (sequence 1, CGGCAAAGATCATCCATATAT; sequence 2, ACTTAGTTCAGAAACCTTAAA). The shRNA sequences targeted mouse SMYD2 (sequence 1, CCATTTGGGATCGGCGATATT; sequence 2, CCGGCTAAGAGACTCCTATTT).

Tang M., Chen G., Tu B., Hu Z., Huang Y., DuFort C.C., Wan X., Mao Z., Liu Y., Zhu W.G, & Lu W. (2023). SMYD2 inhibition–mediated hypomethylation of Ku70 contributes to impaired nonhomologous end joining repair and antitumor immunity. Science Advances, 9(24), eade6624.

+ Open protocol

+ Expand

Cell Culture and Genetic Manipulation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

MCF-10A, MCF-7, ZR-75-30, ZR-75-1, 293T and MDA-MB-231 cells were purchased from ATCC (American Type Culture Collection, Manassas, VA, USA) and cultured according to ATCC instructions. The high-metastasis (HM) MDA-MB-231 HM cell line was derived from the parental MDA-MB-231 cell line, as established by our institute 55 (link). The high-osteolytic-metastasis (BO) MDA-MB-231 BO cell line was obtained as a generous gift from Dr. Toshiyuki Yoneda (The University of Texas, USA) 28 (link), 29 (link). MDA-MB-231 HM and MDA-MB-231 BO cells were cultured similarly to MDA-MB-231 cells 27 .
pCMV6-entry-CAPG-MYC-FLAG and pCMV6-entry were purchased from OriGene Technologies, Inc. pcDNA3-HA and pCMV-FLAG were purchased from Beyotime Biotechnology, Inc. pCDH-puro, pET28a, pGEX-4T-1 and pWPI-puro were purchased from Addgene, Inc. pGL3-Basic was purchased from Promega. The pLKO.1-TRC cloning vector was a gift from David Root 56 (link). The shRNA sequences for shCAPG, shPRMT5 and shSTC-1 are provide in Table S2. All other vectors were constructed by our lab, and the strategies are provided in Table S3. Transfection and lentiviral particles generation were performed as previously described 57 (link), 58 (link).

Huang S., Chi Y., Qin Y., Wang Z., Xiu B., Su Y., Guo R., Guo L., Sun H., Zeng C., Zhou S., Hu X., Liu S., Shao Z., Wu Z., Jin W, & Wu J. (2018). CAPG enhances breast cancer metastasis by competing with PRMT5 to modulate STC-1 transcription. Theranostics, 8(9), 2549-2564.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!