Pcmv6 an his ha plasmid

The plasmids pcDNA3-SOD1(WT) and pcDNA3-SOD1(G93A) were purchased from Addgene (Cambridge, United States) and used as template to amplify by PCR the respective cDNA. Briefly, hSOD1 cDNAs were amplified with AccuPrime DNA polymerase (Invitrogen) and cloned in SgfI and MluI sites of pCMV6-AN-His-HA plasmid (OriGene) to generate a vector, expressing the human SOD1 gene tagged at the N-terminus with polyhistidine (His) tag and HA. For lentiviruses preparation, the His-HA tagged genes were excised from pCMV6-HIS-HA plasmids and subcloned into the BamHI and XhoI sites of the vector pENTR1A (w48-1, Addgene). The resulting vectors were then recombined with pLenti CMV/TO Puro DEST (670-1, Addgene) using Gateway LR-Clonase (Life Technologies) to get the lentiviral vectors expressing hSODWT and its mutant under the control of a doxycycline-inducible promoter. Lentiviruses were then prepared in accordance with the protocols detailed by Campeau et al. (2009) (link), meeting Biosafety Level 2 (BSL-2) requirements.

We performed RBMX knock-down as described in Matsunaga et al. (2012) (link). We used RBMX siRNA-1 (5′-UCAAGAGGAUAUAGCGAUATT-3′) and siRNA-2 (5′-CGGAUAUGGUGGAAGUCGAUU-3′) for knock-down, and negative control siRNA S5C-060 (Cosmo Bio, Japan). 1.5 × 10⁶ HEK293 cells were seeded into two 10 cm Petri dishes and transfected with Lipofectamine 2000, using a mixture of both siRNA at 25 nM.
Full-length RBMX was amplified by PCR using HeLa cells cDNA and the Fw: 5′ GAGGCGATCGCCGTTGAAGCAGATCGCCCAGGAA 3′ and Rv: 5′GCGACGCGTCTAGTATCTGCTTCTGCCTCCC 3′primers. The amplified fragment was digested with the SgfI and MluI restriction enzymes and cloned into the pCMV6-AN-His-HA plasmid (PS100017, OriGene, United States), obtain the pCMV6-HIS-HA-RBMX vector. The construct was confirmed by sequencing. HEK293 cells were transfected as described above, with 2 μg of pCMV6-HIS-HA-RBMX or the mock empty vector as control. RNA extractions were performed 48 h post-transfection. All experiments were run in biological triplicate.