CRC cell lines were purchased from ATCC. DLD-1 MIR21wt and MIR21KO were a kind gift from Jian Yu (University of Pittsburgh Cancer Institute, Pittsburgh, USA) to CMC (Ohio State University Columbus, USA) and RKO MIR21wt and MIR21KO were purchased from Horizon Discovery (Cambridge, UK) and were cultured in McCoy’s 5A or DMEM modified medium, respectively, (Gibco, Carlsbad, CA, USA) under standard conditions at 37 °C with 5% of CO2 in a controlled incubator. All cell lines were supplemented with 10% FBS (Gibco) plus 1% penicillin/streptomycin mixture (Gibco). Human organoids derived from tumour biopsies of metastatic CRC patients were previously described [11 (link)]. All cell models were regularly tested for mycoplasma contamination.
Crc cell lines
Manufactured by American Type Culture Collection
Sourced in United States
CRC cell lines are a collection of human colorectal cancer cell lines maintained by the American Type Culture Collection (ATCC). These cell lines are derived from primary and metastatic colorectal tumors and are widely used in cancer research to study the biology and treatment of colorectal cancer.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (7 mentions)
Rpmi 1640, by Thermo Fisher Scientific (4 mentions)
Mccoy s 5a, by Thermo Fisher Scientific (3 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (3 mentions)
4 6 diamidino 2 phenylindole (dapi), by Santa Cruz Biotechnology (2 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions)
Penicillin streptomycin mixture, by Thermo Fisher Scientific (1 mentions)
Sp600125, by Merck Group (1 mentions)
Z vad fmk, by Merck Group (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Ncm460 cell line, by American Type Culture Collection (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Merck Group (1 mentions)
C src, by Santa Cruz Biotechnology (1 mentions)
C myc, by Cell Signaling Technology (1 mentions)
Bcl xl, by Cell Signaling Technology (1 mentions)
Paxillin, by Cell Signaling Technology (1 mentions)
Phos erk, by Cell Signaling Technology (1 mentions)
Mmp 9, by Cell Signaling Technology (1 mentions)
Dmem f12, by Thermo Fisher Scientific (1 mentions)
Leibovitz s l 15 medium, by Thermo Fisher Scientific (1 mentions)
20 protocols using crc cell lines
1
Establishment and Characterization of CRC Cell Lines
2
CRISPR-Cas9 Knockout of GPX2 in CRC Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRC cell lines were purchased from ATCC (American type culture collection, USA). HCT116, LS174T, and HCT15 cells were respectively cultured in McCoys-5A, MEM, and DMEM media (Gibco, USA) supplemented with 10% FBS, glutamine, and penicillin/streptomycin at 37°C in 5% CO2. All cell lines were validated by STR DNA fingerprinting. Experiments were carried out within 6 months after acquisition of the cell lines. In addition, we ruled out mycoplasma contamination using a PCR-based method.
For CRISPR–Cas9 gene knockout, the human LentiCRISPR v2-GPX2 sgRNAs were purchased from Synbio Technologies. The sgRNA sequences were as follows: GAGCTGGGTGAAGTCCCGGG (#1), AGCCACATTCTCAATCAGCA(#2),GAGCTTGGGATCGGTCATGA(#3), CTAGGAGAACTGTCAGAATG(#4). Briefly, the HCT15 cells were co-transfected with LentiCRISPR v2-GPX2 sgRNAs plasmid and GFP plasmid. Forty-eight hours later, GFP-positive cells were isolated by FACS and seeded at one cell per 96-well. Cells were grown in DMEM supplemented with 10% FBS. Single-cell clones were expanded and depletion of GPX2 was confirmed by western blot.
For CRISPR–Cas9 gene knockout, the human LentiCRISPR v2-GPX2 sgRNAs were purchased from Synbio Technologies. The sgRNA sequences were as follows: GAGCTGGGTGAAGTCCCGGG (#1), AGCCACATTCTCAATCAGCA(#2),GAGCTTGGGATCGGTCATGA(#3), CTAGGAGAACTGTCAGAATG(#4). Briefly, the HCT15 cells were co-transfected with LentiCRISPR v2-GPX2 sgRNAs plasmid and GFP plasmid. Forty-eight hours later, GFP-positive cells were isolated by FACS and seeded at one cell per 96-well. Cells were grown in DMEM supplemented with 10% FBS. Single-cell clones were expanded and depletion of GPX2 was confirmed by western blot.
3
Maintaining CRC Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRC cell lines were purchased from the American Type Culture Collection (ATCC, Manassas, VA). These cells were maintained according to instructions described by ATCC. Z-VAD-FMK and SP600125 were purchased from Sigma-Aldrich (St. Louis, MO, USA).
4
Regulation of SNHG6 in Colorectal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All CRC cell lines and NCM460 cell line were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). All cell lines were cultured in DMEM containing 10% FBS, 100 U/mL penicillin, and 100 mg/mL streptomycin in a humidified incubator at 37°C with 5% CO2. The SNHG6 shRNAs, SNHG6 wild-type plasmids, SNHG6 mutant plasmids, pCMV-E2F5 plasmids, and empty vectors were constructed by Jikai Chemical Technology (Shanghai, China). The shRNA sequences used for targeting SNHG6 were as follows: shRNA1, 5′-GCATATAGGTTGCTGTAGA-3′; shRNA2, 5′-GATGTTGATAACATCACAA-3′. The sh-NC sequence used was 5′-CGATAATGCTGTTAGGAGT-3′. The miRNA mimics and inhibitors were synthesized by RiBo Biological Co. LTD (Guangzhou, China). Cell transfection was performed using the Lipofectamine 2000 reagent (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s instructions.
5
Antibody-Based Regulation of Colorectal Cancer Metastasis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The antibodies used in this study were anti-Arp3; C-myc, Bax, Bcl-xl, Cleaved Caspase3, FAK, Phos-FAK, Phos-PI3K, MMP2, MMP9, tissue inhibitor of metalloproteinases 1 (TIMP1), Paxillin, Phos-Paxillin, Erk, Phos-Erk (Cell Signaling Technology), c-Src, Phos-c-Src (Santa Cruz Biotechnology) and Rac1 (Millipore). DAPI was purchased from Sigma-Aldrich. Phalloidin was provided by Invitrogen. All of the media were obtained from Gibco. All CRC cell lines were obtained from the American Type Culture Collection (ATCC). Medium was supplemented with 10% FBS, penicillin (100 units/ml) and streptomycin (100 units/ml). BALB/c mice and nude mice were from the National Rodent Laboratory Animal Resources, Shanghai Branch of China. All animal experimental protocols were approved by the Animal Investigation Committee of the Institute of Biomedical Sciences, East China Normal University.
6
Culturing and Treating Colorectal Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human colorectal cancer (CRC) cell lines were purchased from American Type Culture Collection (ATCC; Manassas, VA). SW620, SW480 cell lines were cultured in Leibovitz’s L-15 Medium (Gibco, USA). The culture medium for HCT116, HT29, and human colon epithelial cell line NCM460 was McCoy’s 5a (Gibco, USA). Human colon epithelial cell line FHC was cultured in DMEM: F12 (Gibco, USA) medium, and HCoEpiC was cultured in RPMI1640 (Gibco, USA). All cell lines were maintained in basal medium supplemented with 10% fetal bovine serum (FBS, Gibco, USA), 100 units/mL penicillin and streptomycin (Invitrogen, UK). The reagents used to inhibit DNA methylation and histone deacetylation were 5-Aza-2-deoxycytidine (5 mmol/L, 72 h) and Trichostain A (600 nmol/L, 24 h). 5-fluorouraci (F6627) and oxaliplatin (O9512) were from Sigma-Aldrich. 5-Aza-2-deoxycytidine (S1200), Trichostatin A (TSA) (S1045), MG132 (S2619), and RGFP966 (S7229) was from Selleck.
7
CRC Cell Line and Tissue Collection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRC cell lines were obtained from the American Type Culture Collection and were grown in DMEM containing 10% fetal bovine serum and antibiotics. They were free of mycoplasma. Tissue samples of primary tumor and normal colon were obtained from patients undergoing surgery for CRC (Hôpital Saint-Antoine, Paris, France). The MSI status of tumors was assessed as reported previously44 (link).
8
Cell Line Maintenance and LIG4 Depletion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRC cell lines were purchased from the American Type Culture Collection and maintained in Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum. CCD841CoN and FHC cells were cultured in DMEM-F12 containing 10% fetal bovine serum. Mycoplasma contamination was examined using MycoAlert mycoplasma detection kit (Lonza). iCRT14 and SRC7 were purchased from Santa Cruz Biotechnology and Xcess Biosciences, respectively. For depletion of endogenous LIG4, shLIG4 lentiviral plasmids (GIPZ; Open Biosystems) encoding shRNA were stably transduced. Three different LIG4 shRNAs were used (shLIG4 #1: 5′-GGATGATCATAAAGGATTT-3′; shLIG4 #2: 5′-CTATAATCCTAATACACAA-3′; and shLIG4 #3: 5′-TGGTGTTAGTCAGCAAACT-3′).
9
Immunofluorescence Staining of Colorectal Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRC cell lines were purchased from the American Type Culture Collection (Gaithersburg, MD, USA). HCT116 and DLD1 cells were maintained in RPMI-1640 (Gibco; Carlsbad, CA, USA), supplemented with 10% (v/v) fetal bovine serum (Gibco). Cells were allowed to grow in a humidified incubator with 5% CO2 at 37°C. Mycoplasmas were detected in cell cultures stained with 4’,6-diamidino-2-phenylindole (DAPI) (Santa Cruz; Dallas, TX, USA).
Cells were fixed using 4% paraformaldehyde for 20 min at 4°C. Fixed cells were then permeabilized in 0.5% Triton X-100 for 10 min and blocked with 5% bovine serum albumin for 1 h. Primary antibody incubation was performed at 4°C overnight. The cell nuclei were counterstained with DAPI. The images were analysed using the SP8 confocal microscope (Leica; Wetzlar, Germany).
Cells were fixed using 4% paraformaldehyde for 20 min at 4°C. Fixed cells were then permeabilized in 0.5% Triton X-100 for 10 min and blocked with 5% bovine serum albumin for 1 h. Primary antibody incubation was performed at 4°C overnight. The cell nuclei were counterstained with DAPI. The images were analysed using the SP8 confocal microscope (Leica; Wetzlar, Germany).
10
Cell culture protocols for colorectal cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRC cell lines were obtained from the American Type Culture Collection (ATCC) and grown in a medium supplemented with 10% foetal calf serum I (Thermo Fisher Scientific, Waltham, MA, USA). SW480 cells were grown in Leibovitz’s L-15 medium (ATCC, Manassas, VA, USA). HCT116 cells were grown in high-glucose DMEM medium (Thermo Fisher Scientific, Waltham, MA, USA). RKO and Caco2 cells were grown in ATCC-formulated Eagle’s Minimum Essential Medium (ATCC, Manassas, VA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!