Pmrfp lap2β ires puro2b

The following constructs were obtained from Addgene: H2B-eGFP (plasmid 11680, from G. Wahl), emerin-eGFP (plasmid 61985, from E. Schirmer), pmRFP-LAP2β-IRES-puro2b (plasmid 21047, from D. Gerlich). The construct encoding eGFP-BAF was made by recombining full-length human BAF into pLenti-CMV-neo-eGFP vector (T. Kuroda, vector plasmid Addgene 17447, from E. Campeau and P. Kaufman). The construct encoding mRFP-H2B was generated by recombining mRFP-H2B into pBABE-Puro vector (T. Kuroda, vector plasmid Addgene 1764, from H. Land, J. Morgenstern and B. Weinberg). The construct encoding TDRFP-NLS (referred to as RFP-NLS throughout the manuscript) was a gift from A. Salic. The construct encoding mNeonGreen-PCNA was made by recombining mNeonGreen-PCNA into pLENTI CMV Neo DEST vector (N. Umbreit, vector plasmid Addgene 17392, from E. Campeau and P. Kaufman) using Gateway LR Clonase II Enzyme (Invitrogen). Before Gateway cloning (Invitrogen), mNeonGreen-PCNA was first amplified by PCR using Ex Taq polymerase (Takara, primers: Forward 5’ CACCATGGTGAGCAAGGG 3’; Reverse 5’ CCTCTACAAATGTGGTATGGCTG 3’) and then the resulting PCR product was inserted into the pCR8/GW/TOPO vector (Invitrogen), according to the manufacturer’s instructions.

The following constructs were obtained from Addgene: YFP-STIM1 (plasmid 18857, neomycin-resistant, from Tobias Meyer, was a gift from Jeremy Smyth, Uniformed Services University; or plasmid 19754, retroviral and puromycin-resistant, from Anjana Rao), emerin-eGFP (plasmid 61985, from E. Schirmer), eGFP-NUP153 (plasmid 64268, from Birthe Fahrenkrog), F-tractin-mCherry (plasmid 85131, from Tobias Meyer), pmRFP-LAP2β-IRES-puro2b (plasmid 21047, from D. Gerlich). The lentiviral construct for eGFP-CLIMP63 was gift from Tom Rapoport, Harvard Medical School. The retroviral construct for mRFP-H2B was from Liu et al.^{4 (link)} The mCherry-STIM1 construct was from a gift from Khaled Machaca, Weill-Cornell Medicine-Qatar. A retroviral construct for mCherry-STIM1 expression was cloned by replacing the DNA sequence of YFP in the retroviral YFP-STIM1 plasmid (Addgene plasmid 19754 above) with the DNA sequence of mCherry. The lentiviral construct for mRFP-LAP2β expression was cloned by inserting the DNA sequence of mRFP-LAP2β (Addgene plasmid 21047, from D. Gerlich) into a lentiviral expression vector carrying a hygromycin resistance marker. The eGFP-MYO5A, eGFP-MYO5B, eGFP-MYO5C constructs were synthesized by GenScript by inserting the ORFs of the full-length genes into the pcDNA3.1(+)-N-eGFP backbone; the eGFP-MYO5A sequence was also inserted into the pGenLenti (lentivirus) vector.