Tk renilla reporter plasmid

According to the site sequence diagram of Indels in the chicken QPCTL promoter region [8 (link)], the luciferase reporter vector pGL3-basic (Promega, Madison, WI, USA) was selected, and the pGL3-A allele vector (388 bp, including insertions of 224 and 52 bp), pGL3-B allele vector (336 bp, including a deletion of 52 bp and an insertion of 224 bp) and pGL3-C allele vector (164 bp, including an insertion of 52 bp) were constructed through Gene Create (Wuhan, China) to detect the effects of different Indels in the QPCTL promoter region on fluorescence activity. The above plasmids were transfected into DF-1 cells, and the TK Renilla reporter plasmid (Promega) was co-transfected as an internal control.
The luciferase activity of the cells was analyzed by a Luciferase Assay System Kit (Promega) and Fluorescence/Multi-Detection Microplate Reader (BioTek, Winooski, VT, USA) with Gen5 software. The levels of firefly luciferase activities were normalized to those of Renilla luminescence in each well.

Reporter assays were performed as previously described60 (link). The Foxp3 promoter (−422- +20, position at Exon1) was cloned into the pGL4.10 Luciferase reporter plasmid (Promega, catalogue number: E6651). The TK-Renilla reporter plasmid (Promega, catalogue number: E2241) was used as a control. Treg cells, polarized for 42 h as described above and expanded for 1 day were transfected with different Luciferase reporter and control Renilla reporter constructs by using the Mouse T Cell Nucleofector Kit (LONZA, catalogue number: V4XP-3032) according to the manufacturer's instructions. Sixteen hours after electroporation, T cells were re-stimulated for 6 h with PMA (25 ng ml⁻¹, Santa Cruz) and Ionomycin (1 μg ml⁻¹, Santa Cruz) and then harvested and measured with the Dual Luciferase reporter system (Promega, catalogue number: E1910). Renilla activity was used to normalize transfection efficiency and Luciferase activity.

The luciferase constructs containing the GDF15 promoter were amplified from human genomic DNA (Promega). The following primers were used to generate each construct: pGL3-GDF15-a (−966/+70 clone): forward primer TCTAGAACTCTTGACGTCAGATGATC and reverse primer TGAGAGCCATTCACCGTCCTGAGTTC; pGL3-GDF15-b (−133/+70 clone): forward primer CACCCCCAGACCCCGCCCAGCTGTGGTCATTG and reverse primer TGAGAGCCATTCACCGTCCTGAGTTC; and pGL3-GDF15-c (−966/+41 clone): forward primer TCTAGAACTCTTGACGTCAGATGATC and reverse primer TGTGCAGGTTGCGGCTATGAGCTGGG. After PCR, each fragment was cloned into pGL3-Basic vector (Promega) digested with XhoI/HindIII restriction enzymes. HeLa cells were transfected with 1 μg of the pGL3-Basic vectors containing different lengths of the GDF15 promoter together with 0.1 μg of TK-Renilla reporter plasmid (Promega) as an internal control. After 24 h of transfection, cells were treated with or without 25 μg/mL CRP for 18 h and RL and FL activities were measured using the Dual-Luciferase® Reporter Assay System (Promega) as per the manufacturer's instructions.