Pierce agarose chip assay kit

Manufactured by Thermo Fisher Scientific

The Pierce Agarose ChIP Assay Kit is a kit designed for chromatin immunoprecipitation (ChIP) experiments. It provides pre-optimized reagents and protocols to aid in the isolation and analysis of protein-DNA complexes from cells or tissues.

Automatically generated - may contain errors

Lab products found in correlation

Imprint rna immunoprecipitation kit, by Merck Group (1 mentions)

Close spelling variants of this product

Agarose (403 citations) Pierce Agarose ChIP Kit (249 citations) ChIP assay kit (54 citations) ChIP kit (45 citations) Agarose ChIP Kit (15 citations) Pierce ChIP Kit (3 citations) ChIP) assay (3 citations)

2 protocols using pierce agarose chip assay kit

ChIP-Seq and RIP Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

For chromatin immunoprecipitation (ChIP) experiments, the Pierce Agarose ChIP Assay Kit (Thermo Fisher Scientific) was used. RNA immunoprecipitation (RIP) was performed using Imprint® RNA Immunoprecipitation Kit (Sigma Aldrich); see Supplementary Methods for protocols.

Amodio N., Stamato M.A., Juli G., Morelli E., Fulciniti M., Manzoni M., Taiana E., Agnelli L., Cantafio M.E., Romeo E., Raimondi L., Caracciolo D., Zuccalà V., Rossi M., Neri A., Munshi N.C., Tagliaferri P, & Tassone P. (2018). Drugging the lncRNA MALAT1 via LNA gapmeR ASO inhibits gene expression of proteasome subunits and triggers anti-multiple myeloma activity. Leukemia, 32(9), 1948-1957.

+ Open protocol

+ Expand

ChIP-qPCR Assay for SRF Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP assays were performed using the Pierce^™ Agarose ChIP Assay Kit (Thermo Scientific, Catelog # PI26156) according to manufacture instruction. The cross-linked chromatin from subconfluent PAC1 cells in 10% FBS was immunoprecipitated using anti-SRF antibodies (Santa Cruz, sc-335), followed by qPCR using primers specific to the Nik promoter in a region containing the CArG box (Forward primer: 5′—TGTTCAGCCCATTTTTAGGC -3′, Reverse primer: 5′- TTTAGCATTGTGCGAGTGTC -3′) (S2 Table).

Dai X., Thiagarajan D., Fang J., Shen J., Annam N.P., Yang Z., Jiang H., Ju D., Xie Y., Zhang K., Tseng Y.Y., Yang Z., Rishi A.K., Li H.J., Yang M, & Li L. (2017). SM22α suppresses cytokine-induced inflammation and the transcription of NF-κB inducing kinase (Nik) by modulating SRF transcriptional activity in vascular smooth muscle cells. PLoS ONE, 12(12), e0190191.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!