Superscript 4 first strand synthesis system

Nucleotide sequence of Ig H and L chain V regions of HMD22 mAb was determined by reverse transcription PCR. In brief, the total RNA isolated from the HMD22 hybridoma clone producing a solFcµR-specific mAb of IgG1κ isotype was converted to first-strand cDNA by using SuperScript™ IV First-Strand Synthesis System (Invitrogen) with an oligo(dT)₁₈. The resultant first strand cDNA was used as a template DNA for amplification of cDNA encoding Ig H and L chain variable (IGHV and IGKV) regions with a set of primers: (i) DO-021 (5’-aggtsmarctgcagsagtcwgg-3’) and DO-023 (5’-ggacagggmtccakagttcc-3’) corresponding with universal VH leader and Cγ for IGHV; and (ii) DO-024 (5’-ccagatgtgtgatgacccagactcca-3’) and DO-025 (5’-gttggtgcagcatcagc-3’) corresponding with Vκ leader and Cκ for IGKV (13 (link)). (In IUPAC nt code, K = G or T; M = A or C; R = A or G; S = G or C; W = A or T) Each amplification reaction underwent 35 cycles of: denaturation at 94°C for 1 min, annealing at 62°C for IGHV or 54°C for IGKV for 20 sec, and extension at 62°C for 80 sec. A final extension was performed at 72°C for 10 min. The amplified products with the expected size (~540 bp for IGHV and ~350 bp for IGKV) were gel-purified and subcloned into the ZeroBlunt TOPO vector (Invitrogen) before sequencing analysis. The sequence was analyzed by IMGT/V-Quest program (16 (link)).

Total RNA was isolated from treated cells using Trizol reagent (Invitrogen) according to the manufacturer's instructions. DNaseI was added into the lysis buffer to avoid DNA contamination. Cytoplasmic and Nuclear RNA purification was perfumed using the purification kit (Norgen, Canada) according to the manufacturer’s protocol. 1 μg total RNA from each sample was subjected to reverse transcription using the SuperScript® IV First-Strand Synthesis System (Invitrogen) before PCR amplification using 1 × Power SYBR® Green PCR Master Mix (Invitrogen). Relative expression levels of lncRNA or mRNA were normalized to 18S RNA and GAPDH mRNA, respectively, as internal controls. The following primers were used in this study:
lncRNA CIR forward primer: 5′-ACACTTGCAAGCCTGGGTAG-3′
lncRNA CIR reverse primer: 5′-CCATTTTCCTGTTGGTGCGG-3′
ATOH8 forward primer: 5′-CCTGAGGATCGCCTGTAACT-3′
ATOH8 reverse primer: 5′-TGTCAAAGGCTCCGAAAAGT-3′
18S RNA forward primer: 5′- CAGGATTGACAGATTGATAGC TCT-3′
18S RNA reverse primer: 5′-GAGTCTCGTTCGT TATCGGAATTA-3′
GAPDH forward primer: 5′-CCAGGTGGTCTCCTCTGA-3′
GAPDH reverse primer: 5′-GCTGTAGCCAAATCGTTGT-3’

We used a Qiagen RNeasy Plus Mini kit to extract mRNA. The mRNA was converted to cDNA using a SuperScript IV First-Strand Synthesis System (Invitrogen) according to the manufacturer’s instructions. Supplementary Materials Table S1 lists the primers. We then performed real time-PCR (RT-PCR) using a KAPA SYBR FAST kit (Kapa Biosystems), and the experiments were performed in triplicate. The expression level of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used as the internal control.