The antibodies used in this study are listed in Supplementary Materials and Methods. The chemical inhibitors used in this study include protein synthesis inhibitor CHX (100 μg/ml; Sigma-Aldrich, #01810), proteasomal degradation inhibitor MG132 (10 μM; Abcam, ab141003), lysosomal degradation inhibitor CQ (25 μM; Sigma-Aldrich, C6628), p97/VCP inhibitor DBeQ (10 μM; Sigma-Aldrich, SML0031), NMS-873 (2 μM; Sigma-Aldrich, SML1128) or CB-5083 (5 μM; MedChem Express, HY-12861), clathrin inhibitor CPZ (30 μM; Sigma-Aldrich, C8138), caveolin inhibitor Nystatin (25 μg/ml; Sigma-Aldrich, N6261), CKI inhibitor D4476 (100 μM; Abcam, ab120220), and deubiquitinase inhibitor N-ethylmaleimide (NEM; 10 mM; Thermo Fisher Scientific, #23030). Other reagents used in this study include puromycin (2 μg/ml; Invivogen, ant-pr-1), blasticidin (2 μg/ml; Invivogen, ant-bl-05), VCP small interfering RNA (siRNA) (sc-37187, Santa Cruz Biotechnology), and recombinant Wnt5a proteins (R&D Systems, 645-WN).
Ant pr 1
Manufactured by InvivoGen
Sourced in United States, France
The Ant-pr-1 is a laboratory instrument designed for the detection and analysis of proteins. It utilizes advanced detection methods to provide accurate and reliable protein measurement capabilities. The core function of the Ant-pr-1 is to facilitate protein quantification and characterization in research and analytical applications.
Automatically generated - may contain errors
Lab products found in correlation
Puromycin, by InvivoGen (16 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (7 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (7 mentions)
Ant bl 1, by InvivoGen (6 mentions)
Polybrene, by Merck Group (5 mentions)
Ant bl, by InvivoGen (3 mentions)
Pspax2, by Addgene (3 mentions)
Pmd2 g, by Addgene (3 mentions)
Cycloheximide (chx), by Merck Group (3 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (3 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (3 mentions)
Opti mem, by Thermo Fisher Scientific (3 mentions)
Polybrene, by Santa Cruz Biotechnology (2 mentions)
Puromycin, by Addgene (2 mentions)
Lenticrispr v2, by Addgene (2 mentions)
Blasticidin, by InvivoGen (2 mentions)
Pspax2 packaging plasmid, by Addgene (2 mentions)
Mouse nipbl shrna construct, by Thermo Fisher Scientific (2 mentions)
Gfp shrna, by Addgene (2 mentions)
Pmd2 g envelop plasmid, by Addgene (2 mentions)
69 protocols using ant pr 1
1
Chemical Modulators of Cellular Processes
2
Lentiviral-mediated Knockdown in GC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standard protocols were followed to generate viruses, and packaging lentiviruses were used for constructing the stable transgenic cells.
The lentiviral packaging plasmids psPAX2 and pMD2.G and shRNA were used to generate the lentiviral particles in the HEK293T cells.
The supernatants containing virus particles were collected at 48 h and 72 h post-transfection and concentrated using a lentivirus precipitation
solution (#FV101-01, Transgen Biotech, Beijing, China). The concentrated virus particles and polybrene (1:1000, #C0351, Beyotime, Shanghai, China)
were used to infect the GC cells grown in 6-well plates. The stable shRNA-expressing cells were selected using puromycin
(0.25 mg/mL, #ant-pr-1, InvivoGen, San Diego, CA, USA) for 3–5 days. The shRNA sequences were as follows:
shRNA#1: 5′-CCGGAGAGTTGTGGACTTTAT-3′.
shRNA#2: 5′-CAACCTCACGACCGGATCAT-3′.
shRNA#3: 5′-GCAACGGGTGGAGCAGTTTGC-3′.
The lentiviral packaging plasmids psPAX2 and pMD2.G and shRNA were used to generate the lentiviral particles in the HEK293T cells.
The supernatants containing virus particles were collected at 48 h and 72 h post-transfection and concentrated using a lentivirus precipitation
solution (#FV101-01, Transgen Biotech, Beijing, China). The concentrated virus particles and polybrene (1:1000, #C0351, Beyotime, Shanghai, China)
were used to infect the GC cells grown in 6-well plates. The stable shRNA-expressing cells were selected using puromycin
(0.25 mg/mL, #ant-pr-1, InvivoGen, San Diego, CA, USA) for 3–5 days. The shRNA sequences were as follows:
shRNA#1: 5′-CCGGAGAGTTGTGGACTTTAT-3′.
shRNA#2: 5′-CAACCTCACGACCGGATCAT-3′.
shRNA#3: 5′-GCAACGGGTGGAGCAGTTTGC-3′.
3
Generating Inducible Overexpression ST2 Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate stable ST2 cell lines with integration of CopGFP gene, Ahr gene or Glis1 gene under a Tet-On 3G promoter (ST2-TetOn-GFP, ST2-TetOn-AHR, and ST2-TetOn-GLIS1, respectively) for inducible overexpression of the indicated genes, ST2 cell were transduced with lentiviral particles from Sirion Biotech (Germany) at a MOI of 2.0 together with reverse tetracycline transactivator (rtTA) under the control of the mouse cytomegalovirus promoter (mCMV). Transduced ST2 cells were then selected by adding puromycin (InvivoGen, ant-pr-1) to the growth medium at a concentration of 1 μg/ml. Induction of CopGFP, Ahr or Glis1 was achieved by adding doxycycline (Takara, 631311) at a concentration of 1 μg/ml (stock concentration 1 mg/ml in sterile filtered distilled water).
4
Culturing Murine Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Platinum-E retroviral packaging (PlatE) cell line (Cell Biolabs, RV-101) was grown in Dulbecco’s Modified Eagle Medium (DMEM; Corning, 10–013-CV) supplemented with 10% fetal bovine serum (FBS), antibiotic-antimycotic solution (Corning, MT30004), 1 μg/mL puromycin (InvivoGen, ant-pr-1), and 10 μg/mL blasticidin (InvivoGen, ant-bl-1). Mouse colon adenocarcinoma cell lines with or without CEA expression (MC38/CEA or MC38, respectively) were grown in DMEM supplemented with 10% FBS, and antibiotic-antimycotic solution. GFP-expressing mouse colon adenocarcinoma cell line (MC38/GFP) and GFP-expressing mouse breast adenocarcinoma cell line (E0771/GFP) were grown in DMEM supplemented with 10% FBS, antibiotic-antimycotic solution, and 1 μg/mL puromycin. GFP-expressing, CEA-positive mouse colon adenocarcinoma cell line (MC38/CEA/GFP) and GFP-expressing, CEA-positive mouse breast adenocarcinoma cell line (E0771/CEA/GFP) were grown in DMEM supplemented with 10% FBS, antibiotic-antimycotic solution, and G418 Sulfate.
5
Titration and Transduction of GeCKOv2 Library
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each batch of virus was titrated by transduction of 1.2 × 105 BR16-Cas9-GFP-A2 or BR16-Cas9-GFP-H3 cells per well in a 6-well plate with different dilutions of the virus in each well. For each viral concentration, two replicate wells were seeded. After 24 hours, medium containing 2 μg/mL puromycin (Invivogen, ant-pr-1) was exchanged in one of the replicate wells. A non-virus control was always included and untransduced control cells did not survive 72 hours puromycin treatment. After puromycin selection, live and dead cells were counted, to identify the viral volume that resulted in 30% of cells surviving in puromycin-containing medium, corresponding to an MOI of 0.3 and a single-infection percentage (SIP) of 83% if the infection events are considered as independently-occurring. The SIP was calculated directly from the puromycin survival (Psurvival) as described previously (15 (link)). For each transduction replicate of the GeCKOv2 (a+b), a total of 1.2 × 108 cells were infected at MOI = 0.3, and cultured under puromycin at 2 μg/mL for seven days. After this selection, 6 × 107 cells were spun down at 800 rpm for 6 minutes and used for genomic DNA extraction, whereas the remaining cells were used for transplantation in mice.
6
Cell Culture Protocols for HeLa and Tet-Inducible Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa cells were a gift from John Moran [15 (link)]. Tet-HeLa cells were from Clontech (Mountain View, CA). Tet-293 cells were a gift from Jef Boeke [51 (link)]. All cells were grown in Dulbecco’s Modified Eagle Media (Invitrogen #11965118) supplemented with 10% fetal bovine serum (Invitrogen, #16000069) and 1% Penicillin/Streptomycin (Invitrogen, #15140122). Puromycin resistant plasmids were selected with 1 μg/mL Puromycin (Invivogen #ant-pr-1) and maintained with 0.25 μg/mL Puromycin. Tet-inducible proteins were induced with 500 ng/mL doxycycline (Fisher Scientific #BP2653). Cells were grown at 37°C unless otherwise specified.
7
Dual Fluorescent Lentiviral Transduction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene transfer lentiviral plasmid pSIN-SFFV-GFP Ub-EmGFP was kindly provided by Dr. Yasuhiro Ikeda (Mayo Clinic, Rochester, MN). This plasmid allows the dual Emerald GFP and firefly luciferase expression. Lentiviral transfer shRNA plasmids directed against mouse ADAM10 (TRCN0000031848, TRCN0000031844) and non-target control shRNA were purchased from Sigma-Aldrich (SHC005 and SHC012). Lentiviral vectors (rLV) were generated by the GIGA Viral Vectors platform (University of Liège, Belgium). AB12 cells were first transduced with rLV allowing the dual expression of EmGFP and luciferase. Transduced cells were selected by FACS using EmGFP signal and then transduced with rLV shRNA (TRCN0000031848, SHC005 and SHC012) and selected by puromycin (Invivogen, ant-pr-1). PM27 cells were transduced with shRNA rLV (TRCN0000031844, SHC005 and SHC012) and selected by puromycin.
8
CRISPR Knockout of BRCC3 in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Kasumi-1, SKNO-1, THP-1, OCI-AML5, HEK-293T, and 32D cell lines stably expressing the Cas9 enzyme were generated using the pLKO5d.SFFV.SpCas9.P2A.BSD lentiviral vector and selected with blasticidin (10 µg/ml) (ant-bl, InvivoGen, San Diego, CA, USA). Presence of the FLAG-tagged Cas9 enzyme was confirmed by western blot. When generating a BRCC3 or Brcc3 knockout, vectors containing one or multiple sgRNA against BRCC3 or Brcc3 were introduced into the cell using the pLKO5.sgRNA.EFS.PAC plasmid and selected with puromycin (2 µg/ml) (ant-pr-1, InvivoGen). The following sgRNA-sequences were used: BRCC3 #1: AGCGTGGTTGAGACAAACG; BRCC3 #2: TCTAGTTGAACGATGATACA; Brcc3 #1: GGAGGTAAGTTGGCCACCT; Brcc3 #2: TGTGTATAGGGGAGGTAAGT; Brcc3 #3: TGTCATCATTCAACTAGAGT; Luciferase control: AGTTCACCGGCGTCATCGTC. The knockout was confirmed by western blot and Sanger sequencing.
9
Lentiviral Transduction and STING1 Overexpression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All pre-designed shRNA constructs in a lentiviral format were purchased from Sigma-Aldrich, as described in Key resources table . We seeded 1 × 105 cells in each well of a 12-well plate in 500 μL of complete medium and transduced them by lentiviral vectors at an MOI of 10:1. Transduction was carried out in the presence of polybrene (8 μg/mL; TR-1003-G, Sigma-Aldrich). After recovering with complete culture medium, puromycin (5 μg/mL; ant-pr-1, InvivoGen) was used for the selection of transduced cells. STING1 expression plasmid (SC321845, OriGene Technologies) was transfected into THP1 cells (1 × 106) using Lipofectamine 3000 reagent (L3000-015, Invitrogen) according to manufacturer’s instruction. LyoVec (lyec-12, InvivoGen) was used as a nucleic acid complexing agent to facilitate the cellular entry of RNA or DNA-based oligonucleotides.
10
Lentiviral Inducible Expression and CRISPR-Cas9 Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For doxycycline-inducible lentiviral expression of a constitutively nuclear human FOXO1 (FOXO1A3), FLAG-tagged FOXO1A3 was cloned into pLVX-TetOne-Puro (Clontech). For CRISPR–Cas9 genome editing, gene-specific gRNA sequences (Supplementary Table 4 ) were cloned into a plentiCRISPRv2 plasmid co-expressing FLAG-tagged Cas9 nuclease and a puromycin-selection marker (Addgene, 52961). The FUCCI lentiviral reporters mCherry-hCdt1(30/120)-pCSII-EF and mVenus-hGeminin(1/110)-pCSII-EF56 (link) were obtained from the Laboratory for Cell Function Dynamics, CBS, RIKEN, Japan.
Lentivirus production was performed by co-transfection of HEK293FT cells with pMD2.G (Addgene, 12259), psPAX2 (Addgene, 12260) and transfer plasmids, accordingly. Transfections were carried out using Lipofectamine 2000 transfection reagent (Life Technologies) as previously described57 (link). Viruses were collected 48 and 72 h after transfection, filtered through a 0.45-μm filter and incubated with HUVECs for 16 h in the presence of 8 µg ml−1 polybrene (Santa Cruz). After transduction, cells were expanded for 48 h and selected with EBM containing 1 µg ml−1 puromycin (InvivoGen, ant-pr-1).
Lentivirus production was performed by co-transfection of HEK293FT cells with pMD2.G (Addgene, 12259), psPAX2 (Addgene, 12260) and transfer plasmids, accordingly. Transfections were carried out using Lipofectamine 2000 transfection reagent (Life Technologies) as previously described57 (link). Viruses were collected 48 and 72 h after transfection, filtered through a 0.45-μm filter and incubated with HUVECs for 16 h in the presence of 8 µg ml−1 polybrene (Santa Cruz). After transduction, cells were expanded for 48 h and selected with EBM containing 1 µg ml−1 puromycin (InvivoGen, ant-pr-1).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!