Total RNA was isolated using an RNAprep Pure Plant Kit (Tiangen Biotech Co., Ltd., Beijing, China) from tomato leaves under different conditions as indicated in the figure legend. The extracted RNA was reverse‐transcribed using a ReverTra Ace qPCR RT Kit with an enzyme for genomic DNA removal (Toyobo, Osaka, Japan). qRT‐PCR was performed with SYBR Green PCR Master Mix (Takara, Japan) using a LightCycler 480 II detection system (Roche, Germany). The PCR procedure was described previously (Wang et al., 2018 ). The expression levels were normalized to the expression of tomato ACTIN2 gene, which was stably expressed in tomato plants under cold and light stress combined conditions by geNorm algorithm (Livak and Schmittgen, 2001 ; Løvdal and Lillo, 2009 ). Primers are listed in Table S2 .
Light cycler 480 2 detection system
Manufactured by Roche
Sourced in Germany, United States, Switzerland, Japan
The LightCycler 480 II detection system is a real-time PCR instrument designed for quantitative and qualitative nucleic acid analysis. It enables accurate and reliable gene expression analysis, genotyping, and DNA and RNA quantification. The system features a 96-well block format and can perform up to 45 cycles of PCR amplification.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 480 sybr green 1 mix, by Roche (8 mentions)
Quantitect reverse transcription kit, by Qiagen (8 mentions)
Trizol reagent, by Thermo Fisher Scientific (8 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (4 mentions)
Rneasy plus mini kit, by Qiagen (4 mentions)
Lightcycler 480 sybr green 1 master, by Roche (4 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Rneasy kit, by Qiagen (4 mentions)
Lightcycler 480 probes master, by Roche (3 mentions)
Quantitect primer assay, by Qiagen (2 mentions)
Hs hprt1 1 sg quantitect primer assay, by Qiagen (2 mentions)
Single tube custom taqman gene expression assays, by Thermo Fisher Scientific (2 mentions)
Rq1 dnase, by Promega (2 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Sybr master mixture, by Takara Bio (2 mentions)
First strand cdna synthesis kit, by Tiangen Biotech (2 mentions)
Nanodrop 2000c, by Thermo Fisher Scientific (2 mentions)
Superscript vilo cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Takara Bio (1 mentions)
Revertra ace qpcr rt kit, by Toyobo (1 mentions)
47 protocols using light cycler 480 2 detection system
1
Quantitative RT-PCR Analysis of Tomato Gene Expression
2
Real-Time qRT-PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was retrotranscribed with Transcriptor First-Strand cDNA Synthesis Kit (Roche Applied Science, Indianapolis, USA). Real-time qRT-PCR was carried out with Real-Time ready Custom Panel (cat no. 05532914001, config. no. 100064133; Roche Applied Science, Indianapolis, USA) and the LightCycler® 480 Probes Master (Roche Applied Science, Indianapolis, USA) using the Light Cycler 480 II detection system (Roche). Expression values were normalized against three control genes B2M, GAPDH, and RPLP0 of constant expression level. For both microarray and real-time qRT-PCR analyses, a fold change (FC) greater or equal to 1.3 and below 0.7 was considered as a relevant criterion for genes being significantly differentially expressed.
3
Quantitative RT-PCR Analysis of GRASP55 Knockout
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HeLa‐M cells (Control and GRASP55 Knockout) using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions. The yield and the integrity of RNA were determined by spectrophotometer NanoDrop 2000c (Thermo Scientific) and by TAE agarose gel electrophoresis, respectively. RNA (1 μg) was reverse transcribed using QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer’s instructions and subjected to qPCR with gene‐specific primers (Appendix Table S6 ) in the presence of LightCycler®480 SYBR Green I Master Mix (Roche, Switzerland) on a LightCycler®480 II detection system (Roche, Switzerland). Analyses were carried out on biological triplicate samples for each experiment, and they were processed separately. The thermal profile consisted of 10 min at 95°C pre‐incubation, and 40 cycles at 10 s at 95°C, 10 s at 60°C, and 10 s at 72°C. The qPCR data were normalized to the average of the reference gene human hypoxanthine–guanine phosphoribosyltransferase 1 (HPRT1). The fold changes in the relative quantifications were calculated according to the ΔΔCt method. All the commercial kits used are reported in (Appendix Table S7 ).
4
Quantifying TFEB and EGR1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the RNeasy Plus mini kit (Qiagen) according to the manufacturer’s instructions. cDNA was synthesized using the QuantiTect Reverse Transcription kit (Qiagen). qPCR was performed with the LightCycler 480 SYBR Green I mix (Roche) using the LightCycler 480 II detection system (Roche). QuantiTect Primer Assays from Qiagen were used to quantify genes of interest. HPRT1 (Hs_HPRT1_1_SG QuantiTect Primer Assay, Qiagen, QT00059066) was used as an endogenous housekeeping control, and results were displayed as fold change compared to control samples. The following probes were used to quantify TFEB and EGR1: Hs_TFEB_1_SG QuantiTect Primer Assay (Qiagen, QT00069951) and Hs_EGR1_1_SG QuantiTect Primer Assay (Qiagen, QT002185051).
5
Real-time qRT-PCR Analysis of Skin Biomarkers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) was carried out with the Single Tube Custom TaqMan Gene Expression Assays (Thermo Fisher Scientific) and the LightCycler1 480 Probes Master (Roche Applied Science) using the Light Cycler 480 II detection system (Roche Applied Science). Expression values were normalized against control genes: GAPDH and TBP. The TaqMan probes used were as follows: ASAH (Hs00602774_m1), GAPDH (Hs02786624_g1), GLA (Hs00609238_m1), GM2A (Hs00166197_m1), HPSE (Hs00935036_m1), HYAL4 (Hs00202177_m1), IVL (Hs00846307_s1), LAMP1 (Hs00931461_m1), MCOLN1 (Hs01100653_m1), MITF (Hs01117294_m1), MTORC1 (Hs00234508_m1), PPP3CA (Hs00174223_m1), PPP3CB (Hs00236113_m1), PSAP (Hs01551096_m1), S100A7 (Hs01923188_u1), S100A9 (Hs00610058_m1), SMPD1 (Hs03679346_g1), SPHK1 (Hs00184211_m1), TBP (Hs00427620_m1), TFE3 (Hs00232406_m1), TFEB (Hs00292981_m1), and TFEC (Hs00992838_m1). Each experiment of real-time qRT-PCR analysis was repeated at least three times (n). In case of HaCaT cells they were biological replications and data are reported as the mean SD with p < 0.05 considered statistically significant. For skin specimens technical repetitions were conducted.
6
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from leaves using RNA extraction kits (Easy-do Biotech Co., Ltd., China) and reverse transcribed using a HiScript II Q RT SuperMix for qPCR kit (Vazyme Biotech Co., Ltd., China) following the manufacturer’s instructions. The AceQ qPCR SYBR Green Master Mix Kit (Vazyme Biotech Co., Ltd., China) was used to perform real time-quantitative PCR (RT-qPCR) assays on a LightCycler 480 II detection system (Roche, Germany) as described previously [52 (link)]. The housekeeping gene ACTIN2 was used as the internal reference gene. Sequences of primer pairs are listed in Table S1 .
7
Validating RNA-seq Data by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA-seq data were validated using qPCRs for 11 genes up or downregulated according to FPKM values. For real‐time qRT‐PCR analysis, total RNA (2 μg) was treated with RQ1 DNase (Promega, Madison, Wisconsin) and reverse‐transcribed with the SuperScript VILO cDNA Synthesis Kit (Thermo Fisher, Waltham, Massachusetts), according to the manufacturer’s instructions. PCRs were carried out in biological duplicates and three technical replicates using 10 ng of template cDNA, 10 nM target‐specific primers (Table S5 ) and LightCycler 480 SYBR Green I Master (Roche Molecular Systems, Pleasanton, CA) in the LightCycler 480 II detection system (Roche Molecular Systems, Pleasanton, CA) in a volume of 10 μl. GADPH was used as a housekeeping gene.
8
Quantitative Real-Time PCR Analysis of HUVEC Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA (1 µg) isolated from HUVECs with RNeasy (Qiagen, Hilden, Germany), was used to synthesize cDNA with AccuPower RocketScript Cycle RT PreMix (Bioneer Corp., Daejeon, Korea). The abundance of transcripts in the cDNA samples was measured by real-time PCR with specific primers, according to the manufacturer’s instructions. The reactions contained AccuPower GreenStar Mix (Bioneer Inc., Daejeon, Korea), 10 pmol of both forward and reverse primers, and synthesized cDNA. The reactions were subjected to 50 cycles of PCR amplification (95 °C for 10 s, 55 °C for 15 s, and 72 °C for 20 s) using the LightCycler 480 II detection system (Roche, Marlborough, MA, USA). All results were normalized to GAPDH mRNA. The primers used are listed in the supplementary methods (Table S1 ).
9
Quantitative Analysis of Gene Expression in Mycobacterium
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mc2155 and mc2155-Cu strains were cultured in 7H9 medium and collected when OD600 reached 1.0. Total RNA was extracted using RNAprep pure Cell / Bacteria Kit. cDNA was synthesized from 3μg total RNA with the Reverse transcription kit. Quantitative real-time PCR was performed with the Roche LightCycler 480II Detection System using SYBR green SuperRealPremixs. RNA polymerase sigma factor rpoD was used as an internal control. Relative expression levels for each reference gene were calculated. The relative expression ratio of a target gene was calculated based on the threshold cycle (Ct) deviation of mc2155-Cu versus mc2155: Ratio = (2-ΔCt mc2155-Cu) / (2-ΔCt mc2155)(ΔCt = Ct target-Ct control;). The primers are listed in S1 Table .
10
Optimized qRT-PCR Assay for ER Stress Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR (qRT-PCR) was carried out with the LightCycler 480 SYBR Green I mix (Roche) using the LightCycler 480 II detection system (Roche) with the following conditions: 95°C, 5 min; (95°C, 10 s; 60°C, 10 s; 72°C, 15 s) × 20 cycles. For expression studies, the qRT-PCR results were normalized against an internal control (HPRT). The primers used in this study are the following:
GADD34:
Forward 5′-TGAGACTCCCCTAAAGGCCA-3′
Reverse 5′-CCAGACAGCCAGGAAATGGA-3′
ATF4:
Forward 5′-ATGGGTTCTCCAGCGACAAG-3′
Reverse 5′-GAAGGCATCCTCCTTGCTGT-3′
HPRT:
Forward 5′-TGCTGACCTGCTGGATTACA-3′
Reverse 5′-CCTGACCAAGGAAAGCAAAG-3′
TFEB:
Forward 5′-AGGAGTTGGGAATGCTGATC-3′
Reverse 5′-TGTAATCCACAGAGGCCTTG-3′
TFE3:
Forward 5′-GAACTGGGCACTCTCATCCC-3′
Reverse 5′-CCGGCTCTCCAGGTCTTTG-3′
XBP1: Amplicon length, condizioni PCR, C + C-, %gel.
hXBP1Fw: AAACAGAGTAGCAGCTCAGACTGC
mXBP1Rev: TCCTTCTGGGTAGACCTCTGGGA
GADD34:
Forward 5′-TGAGACTCCCCTAAAGGCCA-3′
Reverse 5′-CCAGACAGCCAGGAAATGGA-3′
ATF4:
Forward 5′-ATGGGTTCTCCAGCGACAAG-3′
Reverse 5′-GAAGGCATCCTCCTTGCTGT-3′
HPRT:
Forward 5′-TGCTGACCTGCTGGATTACA-3′
Reverse 5′-CCTGACCAAGGAAAGCAAAG-3′
TFEB:
Forward 5′-AGGAGTTGGGAATGCTGATC-3′
Reverse 5′-TGTAATCCACAGAGGCCTTG-3′
TFE3:
Forward 5′-GAACTGGGCACTCTCATCCC-3′
Reverse 5′-CCGGCTCTCCAGGTCTTTG-3′
XBP1: Amplicon length, condizioni PCR, C + C-, %gel.
hXBP1Fw: AAACAGAGTAGCAGCTCAGACTGC
mXBP1Rev: TCCTTCTGGGTAGACCTCTGGGA
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!