Genomic DNA and RNA were extracted from EDTA blood samples using a MagNa Pure Compact Nucleic Acid Isolation Kit (Roche,) and ReliaPrep™ RNA Cell Miniprep System (Promega, Madison, WI, USA), respectively. NGS was run in an Ion Torrent PGM platform (Thermo Fisher Scientific, Waltham, MA, USA) using a targeted gene sequencing with an inhouse designed panel of 192 genes involved in IEI (Ampliseq, Thermo Fisher Scientific) (Table S1 ). Candidate STAT2 variant was confirmed by PCR and Sanger sequencing using the following specific primers: cctgtgctttgcttggtttc and gttgagcatctctccctttc. cDNA was synthetized from RNA with a high-capacity cDNA reverse transcription kit (Applied Biosystem, Waltham, MA, USA). Splicing was tested with specific exonic primers (GAGCCAGTTCTCGAAACACC and TGCCTCAGGTGAAACAACAG) using RT-PCR and Sanger sequencing.
Ion torrent pgm platform
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Ion Torrent PGM platform is a next-generation sequencing system designed for targeted, amplicon-based sequencing. It utilizes semiconductor sequencing technology to detect the release of hydrogen ions during DNA synthesis, enabling real-time analysis of genetic sequences.
Automatically generated - may contain errors
Lab products found in correlation
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (4 mentions)
Ion library quantitation kit, by Thermo Fisher Scientific (3 mentions)
Ion plus fragment library kit, by Thermo Fisher Scientific (3 mentions)
Ion xpress plus fragment library kit, by Thermo Fisher Scientific (3 mentions)
Ion pgm template ot2 200 kit, by Thermo Fisher Scientific (3 mentions)
Magna pure compact nucleic acid isolation kit, by Roche (2 mentions)
Ion pgm hi q view ot2 kit, by Thermo Fisher Scientific (2 mentions)
Qiaquick gel extraction kit, by Qiagen (2 mentions)
Ampure xp bead, by Beckman Coulter (2 mentions)
Ion ampliseq library kit 2, by Thermo Fisher Scientific (2 mentions)
Reliaprep rna cell miniprep system, by Promega (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Qiaamp powerfecal pro dna kit, by Qiagen (1 mentions)
Ion pgmtm hi q sequencing kit, by Thermo Fisher Scientific (1 mentions)
Ion pgm hi q sequencing kit, by Thermo Fisher Scientific (1 mentions)
Dnazol, by Thermo Fisher Scientific (1 mentions)
Agencourt ampure xp, by Beckman Coulter (1 mentions)
Pcrbio ultra polymerase red mix, by PCR Biosystems (1 mentions)
Qubit fluorometric quantitation, by Thermo Fisher Scientific (1 mentions)
Ion pgm hi q view sequencing kit, by Thermo Fisher Scientific (1 mentions)
59 protocols using ion torrent pgm platform
1
Targeted gene sequencing for primary immunodeficiency
2
Comprehensive molecular profiling of leukemia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Next generation sequencing (NGS) was performed on the ThermoFisher Ion Torrent PGM platform as described previously [17 (link)]. FLT3-ITD, NPM1 and CALR mutations were detected by fragment analysis (AB 3500XL sequencer), the results of which were analyzed using GeneMapper ID V3.2 software. A total of 131 mRNA isotypes of 41 fusion genes (Supplementary Tables 1 and 2 ), as well as MLL-PTD, IKZF1 and ERG deletion mutations were screened by multiplex-nested reverse-transcription PCR (RT-PCR) according to the protocols we previously reported [18 (link),19 (link)].
3
Extraction and Sequencing of Microbial DNA from Fecal Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Microbial DNAs from the fecal samples were extracted from approximately 200 mg of each stool sample using the QIAamp PowerFecal Pro DNA kit (Qiagen, Valencia, CA, USA) by following the manufacturer’s protocol. To construct sequencing libraries, the V4 to the V5 hypervariable region in the 16S rRNA gene was amplified using the 515 F (5′-barcode-GTGCCAGCMGCCGCGGTAA-3′) and 907 R (5′-barcode-CCGYCAATTCMTTTRAGTTT-3′) indexed reverse primers. The specific PCR conditions are described in a previous study [32 (link)]. Afterward, gel electrophoresis and a Qubit 2.0 Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA) were used to confirm the quality and quantity of the library DNA. The library DNAs were then pooled equally and then purified using an AMPure XP bead (Beckman Coulter, Brea, CA, USA). The libraries were sequenced using an Ion Torrent PGM platform for 1250 flows with the Ion PGMTM Hi Q Sequencing Kit (Thermo Fisher Scientific, USA).
4
GRN Gene Sequencing from Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was obtained from 400 µL of EDTA-anticoagulated peripheral blood, according to standard procedures. GRN gene sequencing was carried out using the Ion Torrent PGM platform (Thermo Fisher Scientific, Waltham, MA USA) by the Ion PGM Hi-Q Sequencing Kit (Thermo Fisher Scientific, Waltham, MA USA). Genetic variants were assessed by Ion Reporter 5.2 Software (Thermo Fisher Scientific, Waltham, MA USA), further verified using Integrative Genomic Viewer (IGV software, Broad Institute, University of California, USA). All pathogenetic variations were confirmed by Sanger Sequencing (SeqStudio, Applied Biosystem by Thermo Fisher Scientific, Waltham, MA USA).
5
Multiplex PCR for CML Genomic Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
High quality genomic DNA was extracted from PB or BM samples from newly diagnosed CML patients using DNAzol (Invitrogen, Thermo Fisher Scientific). Multiplex long-range PCR was performed using different sets of primers as previously described [13 (link)]. The PCR product was used for library generation in the Ion Torrent PGM platform (Thermo Fisher Scientific) according to manufacturer’s instructions. Briefly, PCR products were fragmented with Ion Shear Plus Reagents and purified with Agencourt AMPure XP (Beckman Coulter). Barcoded adapters were ligated according to manufacturer’s instructions with Ion Xpress Plus Fragment Library Kit, and the products were quantified by qPCR. Finally, samples were prepared for emulsion PCR, enriched with Ion PGM Template OT2 200 Kit, and sequenced using Ion 318TM Chip v2 with Ion PGM Sequencing 200 Kit v2.
6
Bacterial 16S rRNA Gene Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both DNA and cDNA extracts were PCR amplified using a set of primers (515F-806R) specific to the V4 hypervariable region of the bacterial 16 s rRNA gene108 . The PCR reaction mixture contained (per 25 µL): 1 × PCRBIO Ultra Polymerase red mix (PCR BIOSYSTEMS, United Kingdom), 0.4 μM forward primer and 0.4 μM reverse primer. The PCR conditions were an initial denaturation at 95 °C for 5 min, followed by 30 cycles of: denaturing 30 s at 95 °C, annealing at 1 min 56 °C, elongation at 1 min 72 °C and final elongation for 5 min at 72 °C. PCR products were precipitated as previously decribed107 , and re-suspended in 20 µl of molecular grade water. Purified PCR products were quantified using Qubit fluorometric quantitation (ThermoFisher) and sequenced using the Ion Torrent PGM platform by the company Molecular Research LP (Texas, USA).
7
NGS Library Preparation and Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Libraries were prepared from the PCR products using an IonPGM fragment library preparation kit (Thermo Fisher Scientific) as previously described.15 Briefly, PCR amplicons were ligated to barcode adapters and P1 adapters before amplification. The amplified libraries were quantitated using quantitative PCR with the Ion Library Quantitation kit according to the manufacturer's instructions (Thermo Fisher Scientific). Libraries were then subjected to deep sequencing on the Ion Torrent PGM platform according to the standard protocol for 300 base‐pair single‐end reads (Thermo Fisher Scientific). Sequencing data were analyzed using Variant Caller 5.0 (Thermo Fisher Scientific). Results of RHOA mutation analysis of 50 PTCL samples using NGS were previously described (Table S2 ).16
8
Feline Respiratory Microbiome Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Respiratory microbiomes in all feline BALF (24 in total) and lung tissues (16 in total) were investigated using NGS. PanB products covering the V5-V8 portion of bacterial 16S rDNA were produced as described earlier for Sanger sequencing. PCR products of approximately 650 bp were purified using QIAquick Gel Extraction Kit (Qiagen, DE) and subjected to NGS library building using NEBNext® Fast DNA Library Prep Set for Ion Torrent kit (NEB, USA) according to the manufacturer’s instructions. Final libraries were quantified using Ion Plus Fragment Library kit (Thermo Fisher Scientific, USA) and 10 pM library pool was used as a template for emulsion PCR using Ion PGM™ Hi-Q™ View OT2 Kit (Thermo Fisher Scientific, USA). After bead enrichment (OT2 instrument, Thermo Fisher Scientific, USA), a NGS sequencing chip was loaded, typically v316 or v318 (Thermo Fisher Scientific, USA), to reach the sequencing dynamic range of 4–5 orders of magnitude. NGS sequencing was performed using the Ion Torrent PGM platform (Thermo Fisher Scientific, USA) using the Ion PGM™ Hi-Q™ View Sequencing Kit chemistry (Thermo Fisher Scientific, USA). The raw data (pair-ended) obtained were end- and quality-trimmed.
9
Ion Ampliseq Colon and Lung Cancer Panel Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Discrepancies in mutation status were resolved using the Ion Ampliseq Colon and Lung Cancer Panel on the Ion Torrent PGM platform (Thermo Fisher Scientific, NH, USA) following the protocol as previously described (28 (link)). Briefly, 10 ng of genomic DNA from each sample was PCR-amplified and then ligated to different barcodes to generate a library. The libraries were mixed and clonally amplified onto the IonSpheres (ISPs) for template preparation, and sequencing was carried out on a 318 chip using the Torrent Suite Software. Mutations were annotated through Torrent Variant Caller and viewed with Integrative Genomics Viewer. Mutations with a coverage depth of ≥1000 and a minor allele frequency (MAF) ≥5% were considered positive using the Torrent Variant Caller.
10
Ion Torrent Sequencing of Barcoded Libraries
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Barcoded libraries were constructed with Ion XpressTM Plus Fragment Library Kit and Ion XpressTM Barcode Adapters Kit (Thermo Fisher Scientific), according to the manufacturer's protocols. These were quantified by Ion Library Quantitation Kit (Thermo Fisher Scientific), and pooled in equal concentrations of 26 pM per target. The libraries were used as template for emulsion PCR, and Ion Sphere Particles (ISPs) were enriched according to the manufacturer's protocol. Samples were loaded on Ion 316 chips (Thermo Fisher Scientific) as described below and Supplementary Fig. 1 , and sequenced by Ion Torrent PGM platform (Thermo Fisher Scientific). Every sequencing process included negative controls.
Total 6 chips were used. 3 chips were allocated to standard coverage set (‘Std set’) and other 3 chips to high coverage set (‘High set’) for triplicate experiment. Sixteen samples were placed on each chip of Std set, which were composed of 5 original samples, 10 mixed samples, and 1 control. In case of High set, 5 samples were placed on each chip, which were composed of 4 mixed samples of 2.5% and 1.0% MAFs from each pair and 1 control. The expected average coverages were 1,562.5× for Std set and 5,000× for High set.
Total 6 chips were used. 3 chips were allocated to standard coverage set (‘Std set’) and other 3 chips to high coverage set (‘High set’) for triplicate experiment. Sixteen samples were placed on each chip of Std set, which were composed of 5 original samples, 10 mixed samples, and 1 control. In case of High set, 5 samples were placed on each chip, which were composed of 4 mixed samples of 2.5% and 1.0% MAFs from each pair and 1 control. The expected average coverages were 1,562.5× for Std set and 5,000× for High set.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!