Taq dna polymerase 2x master mix red

Genomic DNA was extracted from 200 µl EDTA blood using the QIAamp® DNA Blood Mini Kit (Qiagen, Hilden, Germany). Polymerase chain reaction (PCR) was performed with 2 µl genomic DNA and 30 µl Taq DNA-Polymerase 2x Master Mix Red (Ampliqon, Odense, Denmark) under the following conditions: initial denaturation 94°C for 3 min, 38 cycles with denaturation at 94°C for 30 s, annealing at 60°C for 30 s, elongation at 72°C for 30 s each, and final elongation at 72°C for 10 min (forward primer: 5′ GCC​CTC​AGT​TCT​TCC​CCA​AT 3'; reverse primer 3′ CCC​ACA​CGC​TCA​GAC​TTC​AT 5′). PCR products were digested with BseDI (Thermo Scientific, Dreireich, Germany), and restriction fragments were analyzed by agarose gel electrophoresis. For the various genotypes, results from restriction fragment length polymorphism (RFLP)-PCR were validated by Sanger sequencing.

Full-length sequences of qBK1.7 (~ 8.3 kb) in 20 accessions were obtained using Sanger sequencing. The 20 accessions included 11 accessions carrying the resistance haplotype [IR64 (NSFTV_644), NSFTV_18, NSFTV_19, NSFTV_74, NSFTV_85, NSFTV_137, NSFTV_161, NSFTV_171, NSFTV_209, NSFTV_313 and NSFTV_337] and 9 accessions carrying the susceptibility haplotype [Nipponbare (NSFTV_173), NSFTV_17, NSFTV_66, NSFTV_110, NSFTV_138, NSFTV_145, NSFTV_252, NSFTV_255 and NSFTV_304] at qBK1.7. Genomic DNA was extracted from rice leaves following a standard cetyltrimethylammonium bromide (CTAB) extraction protocol (Doyle 1987 ). Primers used for the sequencing of qBK1.7 are listed in Additional file 2: Table S2. PCR was run using Taq DNA Polymerase 2x Master Mix RED (Ampliqon, Denmark) following the manufacturer’s protocol. Sequence alignment and amino acid translation were conducted using Vector NTI 11 (Invitrogen, USA). The association between the sequences and disease severity index was assessed using the GLM (as mentioned above) in TASSEL 5.2.24.

The MethPrimer tool (http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi) was used to predict the CpG Island based on the promoter sequence provided from UCSC database, and BSP primers were designed according to the standard parameters and synthesized by GenFanAvaran Co. (Tehran, Iran). The PCR reactions were performed using 12 μl of Taq DNA Polymerase 2x Master Mix RED with 2 mM MgCl2 final concentration (Ampliqon, Odense M, Denmark); 2 μl bisulfite treated DNA (approximately 50 ng), 0.5 μl of each forward and reverse primers (10pM), and ddH2O to the final volume of 25 μl. The reactions were conducted in a SimpliAmp thermal cycler device (Applied Biosystems) with a primary denaturation for 5 min at 95 °C followed by 40 cycles of denaturation at 95 °C for 30 Sec, annealing temperature with descending touchdown system (− 0.2 °C) starting at 59 °C for 45 Sec, an extension at 72 °C for 45 Sec; and a final extension at 72 °C for 10 min. Following DNA cleanup procedure using the shrimp alkaline phosphatase enzyme for PCR product purification (Thermofisher Scientific). The products were then sequenced with an ABI PRISM BigDye terminator sequencing kit v1.1 (Life Technologies), and directly analyzed by an automated ABI 3130 Genetic Analyzer (Life Technologies).

The salting out method was used to extract DNA from
peripheral blood samples. Genotyping was performed using
Allele specific polymerase chain reaction (AS-PCR) methods
(10 ). We used primers from the previous study (11 (link)) and the
sequence of four primers (synthesis by metabion international
AG, Germany) was shown as follows:
Arginine-based (G) allele:
F: 5´-TCCCCCTTGCCGTCCCAA-3´
R: 5´-CTGGTGCAGGGGCCACGC-3´
Proline-based (C) allele:
F: 5´-GCCAGAGGCTGCTCCCCC-3´
R: 5´-CGTGCAAGTCACAGACTT-3´
PCR was done in a final volume of 10 μl reaction for each
allele containing: Taq DNA Polymerase 2x Master Mix
RED (Ampliqon, Denmark), 1 μl genomic DNA (200-300
ng), 1 μl of each primer (10 μM, Metabion International
AG, Germany) and adequate DNase free water (Sinaclon,
Iran). Amplification temperature stages were performed
for 5 minutes at 95˚C and then 35 cycles including 30
seconds at 94˚C, 30 seconds at 63˚C, 30 seconds at 72˚C,
followed by 7 minutes at 72˚C in a Veriti 96 well PCR
Thermal Cycler (Thermo Fisher Scientific).

Bacterial DNA was isolated with a DNeasy^® Blood and Tissue kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions, and quantified using a Biodrop Duo (Biochrom, Cambridge, United Kingdom). MLST was performed on seven gene fragments (aroC, dnaN, hemD, hisD, purE, sucA, and thrA; Table S1), as previously described [26 (link)]. In brief, 0.25 μM DNA template and 1 μM of each primer were added to 25 μL Taq DNA polymerase 2X Master Mix Red (Ampliqon, Bie and Berntsen, Herlev, Denmark) before amplification by a T-100 thermal cycler (Bio-Rad Laboratories, Hercules, CA, USA). PCR cycling parameters included denaturation at 94 °C for 10 min, followed by 25 cycles of 94 °C for 50 s, 57 °C for 50 s, 72 °C for 50 s, and elongation at 72 °C for 5 min. All PCR products were sequenced (Genomics Ltd., Taipei, Taiwan), purified, trimmed as indicated, and assigned to sequence types (ST) according to the MLST website (http://enterobase.warwick.ac.uk/species/senterica/allele_st_search, accessed on 15 June 2021).

All isolates obtained from summer mastitis were evaluated with genomic DNA fingerprints generated by BOX‐PCR using BOXA1R (5'‐CTACGGCAAGGCGACGCTGACG‐3') primer (Silva et al., 2008 (link)). Genomic DNA of a reference strain of T. pyogenes (ATCC 19,411) and distilled water were used in BOX‐PCR as positive and negative controls, respectively. Reaction mixtures were prepared in a total volume of 25 µl containing a primer concentration of 2 µM (BIONEER, Korea), 12.5 µl Taq DNA Polymerase 2x Master Mix Red (Cat No. A180306, AMPLIQON), and 100 ng of template DNA. The reactions were carried out as follows: initial denaturation at 95℃ for 2 min, then 34 cycles of 95℃ for 1 min, 53℃ for 1 min, and 72℃ for 5 min, and a final extension step at 72℃ for 10 min. The amplification products (5 µl) were resolved by electrophoresis on 1.5% agarose gel for 3 hr at 70 V and visualized as above. The 1/0 (presence/absence) binary matrices were processed by NTsys program (NTSYSpc version 2.10e) to calculate the similarity coefficients and construct the clustering tree with an unweighted pair‐group method using arithmetic averages (UPGMA). The dendrogram was confirmed to be stable based on our repeated verifications (Figure 3). The similarity cutoff level to identify clonally related isolates was set up at 75% (Hadimli & Kav 2011 ; Silva et al., 2008 (link)).