Abi prism 7500 sequencer

Following animal death and preservation, we used quantitative polymerase chain reaction (qPCR) to quantify Bd-infection intensity of all individuals in the Bd-exposure treatments. Additionally, we investigated Bd-infection status in two unexposed individuals per species per trial as well as every unexposed individual that died during the trials. To sample the individuals for Bd, we used a sterile, fine-tipped, dry swab (Medical Wire and Equipment, Corsham, Wiltshire, England) and swabbed the right ventral surface of individual frogs 10 times including the feet, legs, and drink patch. Individual swabs were placed into sterile screw-capped vials. Bd-DNA was extracted by adding 60 μL of Prepman Ultra (Applied Biosystems, Carlsbad, California), heating the vial for 10 min at 100° C, cooling the vials for 2 min, obtaining the supernatant, then diluting it to a 10% solution. We conducted qPCR using an ABI PRISM 7500 sequencer (Applied Biosystems) according to the methods of Boyle et al. [46 (link)]. All samples were run in triplicate and averaged. If a sample tested positive for Bd-DNA in only one replicate we reanalyzed the sample. If a second analysis was required, we re-swabbed the individual on their left side and analyzed the sample from the second swabbing.

Total RNA was purified using TRIzol reagent (Life Technologies Inc., Carlsbad, CA, USA) according to the supplier’s protocol, and cDNA was synthesized using a Superscript II kit (Life Technologies, Karlsruhe, Germany). The miRNA-specific stem-loop RT primers (miR-214-3p: CTCAACTGGTGTCGTGGAGTCGGCAATTC AGTTGAGCTGCCTGTCT;miR-199a-3p:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTAACCAAT), dNTPs (10 nM), Superscript III reverse transcriptase and 1 µg total RNA were used for the microRNA RT reaction. All the reactions were conducted in an ABI PRISM 7500 sequencer (Applied Biosystems, Foster City, CA, USA).