Pyromark kit

Genomic DNA was extracted from the tumor and modified with sodium bisulfite using an EpiTect Bisulfite Kit (Qiagen). PCR and subsequent pyrosequencing for LINE-1 were performed as previously described by Ogino et al., using the PyroMark Kit (Qiagen) [24 (link)–27 (link)]. This assay amplifies a region of the LINE-1 element (position 305–331 in accession no. X58075), which includes four CpG sites. The amount of C relative to the sum of the amounts of C and T at each CpG site was calculated as a percentage (i.e., 0–100%). The average of the relative amounts of C in the four CpG sites was used as the overall LINE-1 methylation level in a given tumor. We validated our LINE-1 methylation pyrosequencing assay in the published literature [28 (link)].

A pyrosequencing-based methylation assay was used to assess the three CpG sites in the promoter region of LINE-1. To analyze LINE-1 promoter methylation, genomic DNA was extracted from peripheral whole blood cells and modified with sodium bisulfite using an EpiTect bisulfite kit (Qiagen). PCR and subsequent pyrosequencing for LINE-1 were performed with a PyroMark kit (Qiagen). The PCR products were immobilized and converted to the single-stranded form to act as templates in the pyrosequencing reaction using the Pyrosequencing Vacuum Workstation (Qiagen). The amount of C relative to the sum of the amounts of C and T at each CpG site was calculated. The average percentages of the relative amounts of C in the three CpG sites of LINE-1 were used as the overall LINE-1 methylation levels. The position was from 331 to 318 in GenBank accession number X58075. Samples were analyzed with a PyroMark Q24 system (Qiagen).

Genomic DNA (gDNA) was collected from frozen esophageal cancer specimens with a QIAamp DNA Mini Kit (Qiagen, Valencia, CA). gDNA was converted with sodium bisulfite by an EpiTect Bisulfite kit (Qiagen). We performed polymerase chain reaction (PCR) and pyrosequencing for LINE-1 as previously described [15 (link)] with a PyroMark kit (Qiagen). A region of LINE-1 element (position 305 to 331, accession No. X58075) was amplified, including four CpG sites. Using a PyroMark Q24 System (Qiagen), pyrosequencing reactions were performed. Bisulfite-pyrosequencing consists of three steps: bisulfite conversion, PCR amplification, and pyrosequencing analysis. Unmethylated cytosine (C) and methylated cytosine (^mC) are differentiated by bisulfite treatment followed by PCR. In the pyrosequencing step, the ratio C:^mC at each CpG site is measured as the ratio of T:C (where T represents thymine). The C content relative to the C plus T content at each CpG site is expressed as a percentage. In this study, the average relative C content at the four CpG sites was considered as overall LINE-1 methylation level in the tumor.

For the quantitative measurement of DNA methylation levels in individual CpG sites of the TAPBP (7 CpGs) gene (Supplementary Data 22), we pyrosequenced the bisulfite converted DNA using the PyroMark Kit (Qiagen catalog no 978703) as per the manufacturer’s instruction. Briefly, DNA was immobilized onto streptavidin-coated beads in binding buffer for 10 min. The biotin-labeled PCR template was isolated and denaturated using the pyrosequencing vacuum prep tool and incubated with 0.4 μM sequencing primer in annealing buffer (20 mM Tris-acetate, 2 mM MgAc2; pH 7.6). The reaction was incubated at 80 °C for 2 min and cooled down to room temperature for 20 min to allow sequencing primer annealing. The methylation levels at the target CpGs were evaluated by converting the resulting pyrograms to numerical values for peak heights and expressed as the average of all patients for a given CpG site analyzed.

The gDNA samples were bisulfite-converted using the EpiTect Bisulfite Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. The bisulfite-converted DNA (bisDNA) samples were diluted to 20 ng/µL. The polymerase chain reaction (PCR) of the diluted bisDNA samples was performed with the PyroMark^® Kit (Qiagen, Hilden, Germany). According to our established protocol, there was an initial activation period of 15 min. at 95 °C, a 3-step cycle of denaturation (94 °C for 30 s), annealing (58 °C for 5 s), and extension (72 °C for 15 s) for 45 cycles. The PCR process was terminated with a final extension period of 72 °C for 10 min. PyroMark assays (biomers.net, Ulm, Germany), primer sequences, and the sequence to analyze, based on the work by Hunter et al. 2019 [15 (link)], are listed in Table 2.
Gel electrophoresis was performed on a 2% agarose gel using GeneRuler 100 bp DNA Ladder (ThermoFisher Scientific, Waltham, MA, USA) to check the PCR products. CpG methylation was determined using PyroMark Q24 (Qiagen, Hilden, Germany) and PyroMark Gold Q24 Reagents (Qiagen, Hilden, Germany). The nucleotide dispensing order was generated by entering the sequence to be analyzed into the PyroMark Q24 software version 2.0.8 (Qiagen, Hilden, Germany). The methylation at each CpG site was evaluated using the PyroMark Q24 software in the CpG mode.

Bisulfite conversion of gDNA was performed (EpiTect Bisulfide Kit (Qiagen Cat. No. 59104), and regions of interest were amplified by PCR (Qiagen Pyromark Custom Assays, Qiagen PyroMark kit Cat. No. 978703) using a QuantStudio 3 real time PCR system. Pyrosequencing and analysis were performed at the Stanford University School of Medicine’s Beckman Center for Molecular and Genetic Medicine. The regions analyzed and assay numbers are shown in Table 4. Data were analyzed in SPSS (version 28, IBM).

CpG27 was chosen over CpG17 as the CpG27 island was located proximal to the transcription start site for the SDHC gene. A 198 bp sized PCR amplicon in the CpG27 island located in the SDHC promoter region of the SDHC gene was amplified from 50 ng of CT bisulfite converted DNA with 375 nM of forward primer (GAAAATAATTAGTAAATTAGTTAGGTAG) and 187.5 nM of biotinylated reverse primer (ACTAAAATCACCTCAACAACAAC) with the Qiagen PyroMark kit (Qiagen 978703). The PCR conditions were 7 min at 95 °C, followed by 20 sec at 95 °C, 30 sec at 53 °C, and 20 sec at 72 °C for 42 cycles, and an end incubation at 72 °C for 5 min. The resulting PCR amplicon was quality assessed for purity and yield on a 2% agarose gel. A nested sequencing primer (GTTATATGATATTTTTAATTT) at a concentration of 500 nM was used to analyse 12 CpGs in 10ul of the sample on the Qiagen Q24 pyrosequencer. Fully methylated and unmethylated human control DNA that had been treated with bisulfite were used as controls on each pyrosequencing run.
Ten percent of the bisulfite conversion eluate (approximately 50 ng) was used as a PCR template. The lower detection limit of the assay was 10% eluate of 10 ng input DNA for bisulfite conversion (approximately 1 ng) for fresh frozen and DNA isolated from FFPE. Methylation percentage differences of 25% were reliably detectable for 10 ng and 50 ng of template bisulfite converted DNA.