Lipofectmine 2000

THP-1 human macrophages were purchased from Shanghai Institute of Cell Research, Chinese Academy of Sciences; Mtb standard strain H37Rv (ATCC 27294) was preserved by the laboratory. The Ficoll lymphocyte separation medium, fetal bovine serum, and phorbol myristate acetate (PMA) were procured from Sigma (USA); the transfection reagent Lipofectmine 2000 and Trizol from Invitrogen (USA); the PrimeScript reverse transcription reagent kit with gDNA Eraser and SYBR Premix Ex Taq from TaKaRa (Dalian, China); DMEM medium from Hyclone (USA); the Opti-MEM I Reduced Serum Medium for transfection from Gibco (USA); the Middlebrook 7H10 medium and OADC from BD (USA); and the enzyme-linked immunosorbent assay (ELISA) kit detecting human TNF-α and IL-6 from eBioscience (USA). The spectrophotometer was purchased from Bio-Rad (USA), and the Applied Biosystems 7600 thermocycler from ABI (USA).
PBMC Isolation. Morning fasting venous blood was collected in a 5-mL tube with heparin sodium for anticoagulation. PBMCs were routinely isolated using the Ficoll lymphocyte separation medium.

The 3′UTR of EZH2 was amplified by PCR from genomic DNA of HEK293T cells with the following primers: Forward: 5′ AGGTCTAGACCTCTGAAACAGCTGCCTTA 3′ and Reverse: 5′ CCTGAGCTCGCATTATTGCAAAAATTCAC 3′. The 3′UTR was cloned downstream of the luciferase coding sequence in the pMIR-REPORT Luciferase vector (Promega). The construct was confirmed by sequencing. Hsa-miR-138 mimics and none-target control were purchased from GenePharma. And the sequence are as follows: Hsa-miR-138 mimics, Forward: 5′AGCUGGUGUUGUGAAUCAGGCCG 3′and Reverse: 5′GCCUGAUUCACAACACCAGCUUU 3′; none-target control, Forward: 5′ UUCUCCGAACGUGUCACGUTT 3′and Reverse: 5′ ACGUGACACGUUCGGAGAATT 3′.
HEK293T cells were plated in 24-well dishes overnight before transfection. Hsa-miR-138 mimics or none-target control was transfected into HEK293T cells as well as 200 ng of pMIR-REPORT-EZH2 and 20 ng of pRL-renilla by lipofectmine 2000 (Invitrogen). Medium was changed 6 h later. After 48 h, luciferase assay was performed with dual-luciferase reporter assay systems (Promega) according to the manufacturer’s instructions. Measurements were carried out in triplicates and expressed as mean ± SD. Three independent transfection experiments were performed.

HeLa cells were transiently transfected with plasmids as described previously [31 (link)]. Briefly, cells were cultured in 12-well culture plate for 24 h to 60%–70% confluency. Exponentially growing cells were transfected with plasmid mixed with Lipofectmine 2000 (Invitrogen). The expression of fluorescence was observed with confocal microscope CellVoyager CV1000 (Yokogawa, Japan).

Plasmid DNA were transfected into cells using Lipofectmine 2000 (Invitrogen), while siRNA was transfected by siLentFect reagent (Bio-Rad). Luciferase activities were determined using the luciferin reagent (Promega) according to the manufacturer's protocol. Transfection efficiency was normalized to Renilla luciferase activities.

Six human NSCLC cell lines (A549, H1299, H460, H358, H292 and Anip973) were cultured in RPMI1640 medium (Hyclone), and immortalized human bronchial epithelial cell (BEAS-2B) were cultured in DMEM medium (Hyclone), supplemented with 10% FBS (Gibco) and 0.2% penicillin-streptomycin (Hyclone). The miR-652-3p mimics (mim-miR-652), miR-652-3p inhibitor (anti-miR-652), negative control miR mimics and miR inhibitor (mim-miR-NC and anti-miR-NC) were purchased from Ambion and transfected at a final concentration of 30 nM with Lipofectmine 2000 (Invitrogen).