Human T-ALL cell lines HSB-2, MOLT-13, and P12-ICHIKAWA (referred to as P12) as well as CHO-S and CHO-K1 were purchased from DSMZ (German Collection of Microorganisms and Cell Cultures, Braunschweig, DE). Generation and cultivation of human CD38 transgenic CHO-K1 cells (CHO-K1-CD38+) was described previously (21 (link)). MOLT-13 QPCTL Knock-Out (KO) and MOLT-13 CD47 KO were generated using the CRISPR/Cas9 method. The gRNA sequences used for CD47 were 5’ATGCTTTGTTACTAATATGG3’ & 5’AATAGTAGCTGAGCTGATCC3’, and for QPCTL were 5’GCUUCCGAUCAAUGGGACCU3’ & 5’UAAGUGCUCCAGAGACGCUG3’. MOLT-13 control cells were transfected with Cas9 only (without gRNA). Primary T-ALL cells were from patients included in the ALL-BFM study 2000/2009 and described elsewhere (12 (link)).
P12 ichikawa
Manufactured by Leibniz Institute DSMZ
Sourced in United States
The P12-ICHIKAWA is a laboratory instrument used for cell culture applications. It is designed to provide a controlled environment for the cultivation and growth of cells. The core function of the P12-ICHIKAWA is to maintain the necessary conditions, such as temperature, humidity, and CO2 levels, to support the optimal growth and proliferation of cell cultures.
Automatically generated - may contain errors
Lab products found in correlation
Tall 1, by Leibniz Institute DSMZ (4 mentions)
Rpmi 8402, by Leibniz Institute DSMZ (3 mentions)
Pf 382, by Leibniz Institute DSMZ (3 mentions)
Ccrf cem, by American Type Culture Collection (3 mentions)
Dnd41, by Leibniz Institute DSMZ (3 mentions)
Loucy, by Leibniz Institute DSMZ (2 mentions)
Jurkat clone e6 1, by American Type Culture Collection (2 mentions)
Mda mb 468, by American Type Culture Collection (2 mentions)
Hcc1143, by American Type Culture Collection (2 mentions)
Supt11, by Leibniz Institute DSMZ (2 mentions)
Molt 4, by American Type Culture Collection (2 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions)
Glutamax, by Thermo Fisher Scientific (2 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (2 mentions)
Hpb all, by Leibniz Institute DSMZ (2 mentions)
Jurkat, by Leibniz Institute DSMZ (2 mentions)
Molt 13, by Leibniz Institute DSMZ (1 mentions)
Hsb 2, by Leibniz Institute DSMZ (1 mentions)
Cho k1, by Leibniz Institute DSMZ (1 mentions)
Penicillin, by Thermo Fisher Scientific (1 mentions)
7 protocols using p12 ichikawa
1
Generation and Characterization of T-ALL Cell Lines
2
Profiling T-ALL Cell Lines with MYB-Activation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The T-ALL cell lines (27 (link)–29 ) MOLT-4 (ATCC no. CRL-1582), CCRF-CEM (ATCC no. CCL-119), P12-ICHIKAWA (DSMZ no. ACC-34), and RPMI-8402 (DSMZ no. ACC-290) were obtained from ATCC (Manassas, VA, USA) and DSMZ (Braunschweig, Germany). The cell lines have MYB-activation by gene duplication (7 (link), 10 (link)). Cell identity was confirmed by STR-analysis and all cell lines were shown to be mycoplasma free prior to experiments. T-ALL cells were maintained in RPMI-1640 medium with GlutaMAX, 10% or 20% FBS, and 1% penicillin-streptomycin (Thermo Fisher Scientific, Waltham, MA, USA). Human mononuclear cells (Merck, Darmstadt, Germany) isolated from a healthy donor (HMCs) were maintained in Mononuclear cell medium (Merck) according to the instructions of the supplier. All cells were kept in a humidified incubator at 37°C and 5% CO2.
3
Authenticating Cell Lines and PDX Models
4
Authenticating Cell Lines and PDX Models
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell lines and PDX models were routinely authenticated by SNP fingerprinting and tested for mycoplasma. HPB-ALL was obtained from Andreas Strasser. TALL-1, RPMI-8402, SUPT11, Loucy, P12-Ichikawa, PF382 were purchased from DSMZ. Jurkat (clone E6-1), U2OS, MDA-MB-468, HCC1143 were purchased from ATCC. HLR PathDetect cells were purchased from Stratagene. All other cell lines were obtained from the Novartis stocks of the Cancer cell line encyclopedia (27 (link)). T-ALL PDX models were created from primary T-ALLs by injection by tail vein into immunodeficient NOD/Scid/IL2rγnull (NSG) mice and are described at the online portal PRoXe at http://PRoXe.org . Detergent extracts of T-ALL cells obtained from the marrows of leukemia-bearing mice were analyzed for activated NOTCH1 (ICD1) and activated NOTCH3 (ICD3) by Western blotting.
5
Culturing Leukemia Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ke-37, PF-382, TALL-1, HPB-ALL, DND-41, MOLT-4, JURKAT, p12-ichikawa and ALL-SIL were purchased by DSMZ. CCRF-CEM cell lines was obtained by ATCC.
Ke-37, PF-382, TALL-1, DND-41, ALL-SIL, CCRF-CEM, MOLT-4, JURKAT, p12-ichikawa were cultured in RPMI-1640 (Gibco, Life Technologies, Carlsbad, California, USA), supplemented with 10% fetal bovine serum (Lonza Group, Basel, Switzerland), 100 U/mL penicillin and 100 mg/mL streptomycin (Gibco, Life Technologies), and maintained at 37°C in a 5% CO2 atmosphere.
HPB-ALL cell line was cultured in RPMI-1640 supplemented with 20% fetal bovine serum.
Ke-37, PF-382, TALL-1, DND-41, ALL-SIL, CCRF-CEM, MOLT-4, JURKAT, p12-ichikawa were cultured in RPMI-1640 (Gibco, Life Technologies, Carlsbad, California, USA), supplemented with 10% fetal bovine serum (Lonza Group, Basel, Switzerland), 100 U/mL penicillin and 100 mg/mL streptomycin (Gibco, Life Technologies), and maintained at 37°C in a 5% CO2 atmosphere.
HPB-ALL cell line was cultured in RPMI-1640 supplemented with 20% fetal bovine serum.
6
Induction of Apoptosis in T-Cell Leukemia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Jurkat T cells were obtained from Bioresource Collection and Research Center (BCRC, Hsinchu, Taiwan), DND-41, and P12-ICHIKAWA cells were purchased from DSMZ-German Collection of Microorganisms and Cell Cultures GmbH. Jurkat T, DND-41, and P12-ICHIKAWA cells were cultured in 90% RPMI 1640 medium (Gibco BRL, Thermo Fisher Scientific, Waltham, MA, USA) with 10% FBS at 37 °C in a humidified incubator containing 5% CO2. Acridine orange (AO), doxycycline (Dox), 12-O-tetradecanoylphorbol-13-acetate (TPA), and ionomycin (Ion) were purchased from Sigma Aldrich (St. Louis, MO, USA).
7
Cell Culture Protocol for Hematological Malignancies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CCRF-CEM, HH, HUT-78, LOUCY, MJ, MOLT-4, SU-DHL-1 and SUP-T1 cell lines were purchased from the American Type Culture Collection (ATCC) and cultured with Roswell Park Memorial Institute (RPMI) 1640 Medium (Thermo Fisher Scientific) containing 10% fetal bovine serum (Gibco), except for the MJ cell line, which was cultured with Gibco Iscove’s Modified Dulbecco’s Media (IMDM) medium (Thermo Fisher Scientific) containing 20% fetal bovine serum.
BE-13, DND-41, HD-MAR-2, HPB-ALL, HSB-2, JURKAT, KE-37, L-82, MHH-TALL-2, MOLT-14, MOLT-16, P12-ICHIKAWA, PF-382, RPMI-8402, SR-786 and TALL-1 were purchased from the DSMZ German Collection of Microorganisms and Cell Cultures. Except for HSB-2, they were cultured with Roswell Park Memorial Institute (RPMI) 1640 Medium containing different proportions of fetal bovine serum: 10% for DND-41, HD-MAR-2, HPB-ALL, JURKAT, KE-37, L-82, MOLT-14, MOLT-16, P12-ICHIKAWA, PF-382 and RPMI-8402; 20% for BE-13 and MHH-TALL-2; 15% for SR-786 and TALL-1. HSB-2 was cultured with Gibco Iscove’s Modified Dulbecco’s Media (IMDM) medium containing 10% fetal bovine serum.
MyLa was purchased from the European Collection of Authenticated Cell Cultures (ECACC) and was cultured with Roswell Park Memorial Institute (RPMI) 1640 Medium containing 10% fetal bovine serum.
All cells were cultured in CO2 incubators at 37 °C in an atmosphere containing 5% CO2.
BE-13, DND-41, HD-MAR-2, HPB-ALL, HSB-2, JURKAT, KE-37, L-82, MHH-TALL-2, MOLT-14, MOLT-16, P12-ICHIKAWA, PF-382, RPMI-8402, SR-786 and TALL-1 were purchased from the DSMZ German Collection of Microorganisms and Cell Cultures. Except for HSB-2, they were cultured with Roswell Park Memorial Institute (RPMI) 1640 Medium containing different proportions of fetal bovine serum: 10% for DND-41, HD-MAR-2, HPB-ALL, JURKAT, KE-37, L-82, MOLT-14, MOLT-16, P12-ICHIKAWA, PF-382 and RPMI-8402; 20% for BE-13 and MHH-TALL-2; 15% for SR-786 and TALL-1. HSB-2 was cultured with Gibco Iscove’s Modified Dulbecco’s Media (IMDM) medium containing 10% fetal bovine serum.
MyLa was purchased from the European Collection of Authenticated Cell Cultures (ECACC) and was cultured with Roswell Park Memorial Institute (RPMI) 1640 Medium containing 10% fetal bovine serum.
All cells were cultured in CO2 incubators at 37 °C in an atmosphere containing 5% CO2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!